View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17050_high_17 (Length: 245)
Name: NF17050_high_17
Description: NF17050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17050_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 48707402 - 48707631
Alignment:
| Q |
1 |
ttaactgtacttgtacaactaaaatcccaaatcagaaatatggatcatttctcaagtatccaaacaaagaattgatgcttaaacgtaactatgtcccgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48707402 |
ttaactgtacttgtacaactaaaatcccaaatcagaaatatggatcatttctcaagtatccaaacaaagaattgatgcttaaacgtaactatgtcccgct |
48707501 |
T |
 |
| Q |
101 |
gaaaaagacatcaacagtattaaggagaatcacagcatccatcaagaacaaggtcggtcggttggtaatcatgtagctag--tatctctctttttatatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48707502 |
gaaaaagacatcaacagtattaaggagaatcacagcatccatcaagaacaaggtcggtcggttggtaatcatgtagctagtatatctctctttttatatt |
48707601 |
T |
 |
| Q |
199 |
aaagaatatttgtttacttttatttatatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48707602 |
aaagaatatttgtttacttttatttatatt |
48707631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University