View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17050_high_19 (Length: 231)

Name: NF17050_high_19
Description: NF17050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17050_high_19
NF17050_high_19
[»] chr4 (1 HSPs)
chr4 (126-218)||(1159761-1159853)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 126 - 218
Target Start/End: Complemental strand, 1159853 - 1159761
Alignment:
126 tgtgaccttgtcctttctcattgaaatttttaaaccattgaccaaaaaatcatcgtattgtattattaatattctataatctataacatacta 218  Q
    |||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1159853 tgtgaccttgccctttctcagtgaaatatttaaaccattgaccaaaaaatcatcgtattgtattattaatattctataatctataacatacta 1159761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University