View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17050_low_14 (Length: 324)
Name: NF17050_low_14
Description: NF17050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17050_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 144 - 312
Target Start/End: Complemental strand, 49222045 - 49221877
Alignment:
| Q |
144 |
caatttgtcgcttttgaacacttgggtttaggttgtagaataggtagttgtgttgagatacggtcttgtgctggcatgttggnnnnnnnaacatctcaaa |
243 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49222045 |
caatttgtcgtgtttgaacacttgagtttaggttgtagaataggtagttgtgttgagatacggtcttgtgctggcatgttggtttttttaacatctcaaa |
49221946 |
T |
|
| Q |
244 |
aaccatttttgttgaatttaaatatttttattcctgtagtgttttcttgtttctctccctggcccattc |
312 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49221945 |
aaccatttttgttgaatttaaattttttgattcctgtagtgttttcttgtttctctccctgacccattc |
49221877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University