View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17050_low_22 (Length: 231)
Name: NF17050_low_22
Description: NF17050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17050_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 126 - 218
Target Start/End: Complemental strand, 1159853 - 1159761
Alignment:
| Q |
126 |
tgtgaccttgtcctttctcattgaaatttttaaaccattgaccaaaaaatcatcgtattgtattattaatattctataatctataacatacta |
218 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1159853 |
tgtgaccttgccctttctcagtgaaatatttaaaccattgaccaaaaaatcatcgtattgtattattaatattctataatctataacatacta |
1159761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University