View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17051_low_18 (Length: 375)
Name: NF17051_low_18
Description: NF17051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17051_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 4e-91; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 128 - 328
Target Start/End: Original strand, 12045867 - 12046068
Alignment:
| Q |
128 |
caaccaaatagatacaaataaatgatgatgttgcgtgtggtggtgaattttggttgtggtgatgataaggacgagtttgtggattggtcttgtgatttgg |
227 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12045867 |
caaccaaatatatacaaataaattatgatgttgcgtgtggtggtgaattttggttgtggtgatgataaggacgagtttgtggattggtcttgtgctttgg |
12045966 |
T |
|
| Q |
228 |
ggtttgctttgcttttc-tttcgtcggctgctcgtggtgaccttcaatatgggtccatcgtcttcacctctgctcattcgaattgggtggtttgattttg |
326 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
12045967 |
ggtttgctttgcttttcttttcgccggctgctcgtggtgaccttcaatatgggtccatcgtcttcacctctgctcattcaaattgggtggttcgattttg |
12046066 |
T |
|
| Q |
327 |
gg |
328 |
Q |
| |
|
|| |
|
|
| T |
12046067 |
gg |
12046068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 12 - 131
Target Start/End: Original strand, 12045588 - 12045707
Alignment:
| Q |
12 |
agagatatagagaaaatgaattgttgaatggatgtaggaaaattaggtgtatctgccattattgaaaacaatgaagtgtgttatttggacaatcggtttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
12045588 |
agagatatagagaaaatgaattgttgaatggatgtaggaaaattaggtgtatctgccattattgaaaacaatggagtgtgttatttggataatcggtttt |
12045687 |
T |
|
| Q |
112 |
tgaacaacttatggtacaac |
131 |
Q |
| |
|
||||| |||||| ||||||| |
|
|
| T |
12045688 |
tgaacgacttatagtacaac |
12045707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 12015178 - 12015227
Alignment:
| Q |
12 |
agagatatagagaaaatgaattgttgaatggatgtaggaaaattaggtgt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||| ||||| |
|
|
| T |
12015178 |
agagatatagagaaaatgaattgttgaaaggatgtagaaaaattgggtgt |
12015227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 153 - 193
Target Start/End: Complemental strand, 39041771 - 39041731
Alignment:
| Q |
153 |
tgatgttgcgtgtggtggtgaattttggttgtggtgatgat |
193 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39041771 |
tgatcttgtgtgtggtggtgaattttggttgtggtgatgat |
39041731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University