View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17051_low_28 (Length: 237)
Name: NF17051_low_28
Description: NF17051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17051_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 46597734 - 46597566
Alignment:
| Q |
1 |
atttatgttattttgtccacacccaatcaaatatttgatctctcatcatcaacctagtgcatgtgcatccacacttcagcattttatcagctttcctcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
46597734 |
atttatgttattttgtccacacccaaccaaatatttgatcactcatca---acctagtgcatgtgcatccacacttcagtatttgatcagctttcctcat |
46597638 |
T |
 |
| Q |
101 |
ttaagtgtctaattgagtcttataggaactttcatttatatttttgtttttaatcacacttaatatctttta |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46597637 |
ttaagtgtctaattgagtcttataggaactttcatttatattattgtttttaatcacacttaatatctttta |
46597566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 164 - 221
Target Start/End: Complemental strand, 46596094 - 46596037
Alignment:
| Q |
164 |
tatcttttaacattaataattcatctattcaaaaataattgtcatatttacaaaaact |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46596094 |
tatcttttaacattaataattcatctattcaaaaataattgtcatatttacaaaaact |
46596037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University