View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17052_high_11 (Length: 334)
Name: NF17052_high_11
Description: NF17052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17052_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 69 - 325
Target Start/End: Original strand, 27742877 - 27743133
Alignment:
| Q |
69 |
ttgattgttaattagaaggaagtgccattctcaaacacagcaatgagatctcgtgatccgattagtggaatgaaaagtggcggcggtagagggtttggat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27742877 |
ttgattgttaattagaaggaagtgccattctcaaacacagcaatgagatctcgtgatccgattagtggaatgaaaagtggcggcggtagagggtttggat |
27742976 |
T |
|
| Q |
169 |
taccaccaccatcaaaattccggagtggtcatcttcctgctaataagttacccgtctcggctgttgagacattcgatagccgttcaaatagtgatatgga |
268 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27742977 |
taccaccaccatcaaaattcaggagtggtcatcttcctgctaataagttacccgtctcggcggttgagacattcgatagccgttcaaatagtgatatgga |
27743076 |
T |
|
| Q |
269 |
tgccagcgtagattcggaggaggaagtttatggtgggaggtattctttggattcatc |
325 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27743077 |
cgccagcgttgattcggaggaggaagtttatggtgggaggtattctttggattcatc |
27743133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University