View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17052_high_16 (Length: 285)
Name: NF17052_high_16
Description: NF17052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17052_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 149 - 274
Target Start/End: Complemental strand, 51545193 - 51545069
Alignment:
| Q |
149 |
gacttatacatttgcatacgtaacataattgtgatacctatgcaggcagtaggtgagacacggatatggatagcggagtatgtaaactataataatttga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
51545193 |
gacttatacatttgcatacgtaacataattgtgatacctatgcaggcagtaggtgcgacacggatatggatagcggtgta-gtaaactataataatttga |
51545095 |
T |
 |
| Q |
249 |
cgcaacttgaactaaatcagtattca |
274 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
51545094 |
cgcaacttgaactaaatcagtattca |
51545069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 51545361 - 51545243
Alignment:
| Q |
16 |
atttatataatacatgagtgcatatgctgcccac-aaagtcacttttatatccacagtttt-cggtttgtgattgtaattaatt----gttgttaattta |
109 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| | |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
51545361 |
atttatataatacactagtgcaaatgctgccccccaaagtcacttttatatccacagtttttcggtttgtgattgtaattaattaattgttgttaattta |
51545262 |
T |
 |
| Q |
110 |
tccagactttttcttaggc |
128 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
51545261 |
tccagactttttcttaggc |
51545243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University