View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17052_high_9 (Length: 343)
Name: NF17052_high_9
Description: NF17052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17052_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 6e-65; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 15 - 156
Target Start/End: Original strand, 30411322 - 30411463
Alignment:
| Q |
15 |
caaaggggttgttgcaccgaaactgataagccctgcgttgattttattgaaaccccttctctcagctatgcttcttattggtgaaaaatcgacaaacttt |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30411322 |
caaaggggttgttgcaccgaaacttataagccctgcgtttattttattgaaaccccttctctcagctatgcttctttttggtgaaaaatcgacaaacttt |
30411421 |
T |
|
| Q |
115 |
ctatcttttgcatcagaaacattgttgatttcatcaccccca |
156 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30411422 |
ctatcttttgcatcagaaaaattgttgatttcatcaccccca |
30411463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 236 - 326
Target Start/End: Original strand, 30411546 - 30411636
Alignment:
| Q |
236 |
acagtgaaactcaactaagaaaaacagagaattttgacgttgttatgtcaatgttgatggtgaggttcagctccaaagctccataggagtg |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30411546 |
acagtgaaactcaactaagaaaaacagagaattttgacgttgttatgtcaatgttgatggtgaggttcagctccaaagctccataggagtg |
30411636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 46 - 156
Target Start/End: Original strand, 30399033 - 30399143
Alignment:
| Q |
46 |
cctgcgttgattttattgaaaccccttctctcagctatgcttcttattggtgaaaaatcgacaaactttctatcttttgcatcagaaacattgttgattt |
145 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||| |||| ||||||| || ||||||||||||||||| |
|
|
| T |
30399033 |
cctgtgttgattttattgaaaccccttctctcagctatgcttctttttggtgaaaaatcaaaaaagtttccttcttttgaataagaaacattgttgattt |
30399132 |
T |
|
| Q |
146 |
catcaccccca |
156 |
Q |
| |
|
|| |||||||| |
|
|
| T |
30399133 |
caccaccccca |
30399143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 237 - 303
Target Start/End: Original strand, 30399234 - 30399300
Alignment:
| Q |
237 |
cagtgaaactcaactaagaaaaacagagaattttgacgttgttatgtcaatgttgatggtgaggttc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| | | |||||||||| ||||| |
|
|
| T |
30399234 |
cagtgaaactcaactaagaaaaacagagaattttgatgttgttattttatagttgatggtggggttc |
30399300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University