View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17052_low_16 (Length: 285)

Name: NF17052_low_16
Description: NF17052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17052_low_16
NF17052_low_16
[»] chr4 (2 HSPs)
chr4 (149-274)||(51545069-51545193)
chr4 (16-128)||(51545243-51545361)


Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 149 - 274
Target Start/End: Complemental strand, 51545193 - 51545069
Alignment:
149 gacttatacatttgcatacgtaacataattgtgatacctatgcaggcagtaggtgagacacggatatggatagcggagtatgtaaactataataatttga 248  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||    
51545193 gacttatacatttgcatacgtaacataattgtgatacctatgcaggcagtaggtgcgacacggatatggatagcggtgta-gtaaactataataatttga 51545095  T
249 cgcaacttgaactaaatcagtattca 274  Q
    ||||||||||||||||||||||||||    
51545094 cgcaacttgaactaaatcagtattca 51545069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 51545361 - 51545243
Alignment:
16 atttatataatacatgagtgcatatgctgcccac-aaagtcacttttatatccacagtttt-cggtttgtgattgtaattaatt----gttgttaattta 109  Q
    ||||||||||||||  |||||| ||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||    ||||||||||||    
51545361 atttatataatacactagtgcaaatgctgccccccaaagtcacttttatatccacagtttttcggtttgtgattgtaattaattaattgttgttaattta 51545262  T
110 tccagactttttcttaggc 128  Q
    |||||||||||||||||||    
51545261 tccagactttttcttaggc 51545243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University