View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17053_low_9 (Length: 213)

Name: NF17053_low_9
Description: NF17053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17053_low_9
NF17053_low_9
[»] chr8 (3 HSPs)
chr8 (15-213)||(41784735-41784933)
chr8 (19-126)||(41784865-41784972)
chr8 (124-213)||(41784718-41784807)


Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 213
Target Start/End: Original strand, 41784735 - 41784933
Alignment:
15 aaccgaacatactatgatggaagagaaagagggttttcttgcgcggttaaaggaaatggaattcaaattggaaacacaaagcaaccagaaaagtgagttg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41784735 aaccgaacatactatgatggaagagaaagagggttttcttgcgcggttaaaggaaatggaattcaaattggaaacacaaagcaaccagaaaagtgagttg 41784834  T
115 caagaggagttagctgaaatgagatctactgaacaaactatgatggaagagaaagaaggttttcttgcgagattaaagaacatggaactcgaattggaa 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
41784835 caagaggagttagctgaaatgagatctactgaacaaactatgatggaagagaaagaaggttttcttgcgaggttaaagaacatggaactcgaattggaa 41784933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 19 - 126
Target Start/End: Original strand, 41784865 - 41784972
Alignment:
19 gaacatactatgatggaagagaaagagggttttcttgcgcggttaaaggaaatggaattcaaattggaaacacaaagcaaccagaaaagtgagttgcaag 118  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||||| | |||||| || |||||||||| |||| ||| |||| || ||||||| |||    
41784865 gaacaaactatgatggaagagaaagaaggttttcttgcgaggttaaagaacatggaactcgaattggaaactcaaatcaatcagagaaatgagttggaag 41784964  T
119 aggagtta 126  Q
    || |||||    
41784965 agcagtta 41784972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 124 - 213
Target Start/End: Original strand, 41784718 - 41784807
Alignment:
124 ttagctgaaatgagatctactgaacaaactatgatggaagagaaagaaggttttcttgcgagattaaagaacatggaactcgaattggaa 213  Q
    ||||| ||||||| ||| || ||||| |||||||||||||||||||| |||||||||||| | |||||| | |||||| || ||||||||    
41784718 ttagccgaaatgaaatcaaccgaacatactatgatggaagagaaagagggttttcttgcgcggttaaaggaaatggaattcaaattggaa 41784807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University