View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17054_low_2 (Length: 236)
Name: NF17054_low_2
Description: NF17054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17054_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 22598484 - 22598308
Alignment:
| Q |
1 |
tttgtaggccaacaattttgttctatgcagatttagaaagaatattgttacacaagataaagaaagaaagaccattgttcctggacatgcagaaaccacc |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22598484 |
tttgtaggccaacaattatgttctatgcagatttagaaagaatattgttgcacaagataaagaaagaaagaccattgttcctggacatgcagaaaccacc |
22598385 |
T |
|
| Q |
101 |
atatctgtaagttacttgattaattatgttgcttgattgattattaannnnnnnnnagataattgattagttattaa |
177 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22598384 |
atatctgtaagttacttgaataattatgttgcttgattgattattaatttgtttttagataattgattagttattaa |
22598308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 134
Target Start/End: Complemental strand, 17637374 - 17637282
Alignment:
| Q |
42 |
atattgttacacaagataaagaaagaaagaccattgttcctggacatgcagaaaccaccatatctgtaagttacttgattaattatgttgctt |
134 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| | || |||||| || | || ||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
17637374 |
atattgttgcacaagataaacaaagaaagaccgtcattgctggacgtgtggcaaaaaccttatctgtaagttacttgattaaatatgttgctt |
17637282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University