View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17054_low_3 (Length: 209)
Name: NF17054_low_3
Description: NF17054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17054_low_3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 38584353 - 38584145
Alignment:
| Q |
1 |
tatattcaacatcagttatatcagaggactatttcctgagaagtacttcaatgacaagtctgttcccgcgttaggtaaaatcactattcagtcctccagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584353 |
tatattcaacatcagttatatcagaggactatttcctgagaagtacttcaatgacaagtctgttcccgcgttaggtaaaatcactattcagtcctccagt |
38584254 |
T |
|
| Q |
101 |
tgtttgcgttttttactgtttagtgtttacactgaatcttctagtatttgtccttgaatttaacctataactatgctttaataacagagatgaagatcaa |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584253 |
tgtttgcgttttttactgtttaatgtttacactgaatcttctagtatttgtccttgaatttaacctataactatgctttaataacagagatgaagatcaa |
38584154 |
T |
|
| Q |
201 |
aaagctttt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
38584153 |
aaagctttt |
38584145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University