View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17055_high_14 (Length: 285)
Name: NF17055_high_14
Description: NF17055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17055_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 23170909 - 23170711
Alignment:
| Q |
18 |
tgaattgtttggtttatgatttttagatgaagatggtgttttgagcagttcatggtccttaattttgcacaaggagtaaaagatgaggataattaatgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
23170909 |
tgaattgtttggtttatgatttttcgatgaagatggtgttttgagcagttcatggtccttaattttgcacaaggagtaaaagatgagtatgattaatgtt |
23170810 |
T |
|
| Q |
118 |
tctcaaccctctctttctaaattcacgatagtgatacccgtgttagattaaagtggatgtcgatagatcttactaatcatatctagttttataattctc |
216 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23170809 |
tctcaaccctctctttctaaattcaagacagtgatacccgtgttagattaaagtggatgttgatagatcttactaatcatatctagttttataattctc |
23170711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 215 - 268
Target Start/End: Complemental strand, 23169656 - 23169603
Alignment:
| Q |
215 |
tcaaaattgaaagggcacgtggccaaatttaattggacaagttaaggcatgttg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23169656 |
tcaaaattgaaagggcacgtggccaaatttaattggacaagttaaggcatgttg |
23169603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University