View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17055_high_18 (Length: 247)
Name: NF17055_high_18
Description: NF17055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17055_high_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 41554884 - 41554634
Alignment:
| Q |
1 |
agtacctcttaattttatgcagctacagcgacaacacgtcgtagccaacttattgatcaatctacgtgttcacttctaacgtaaacatcttgttctttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
41554884 |
agtacctcttaattttatgcagctacagcgacaacacgtcgtagccaacttactgatcaatctacgtgttctcttctaacgtaaacatcttgttctttca |
41554785 |
T |
 |
| Q |
101 |
aagcgcaaatatcgctatggtacttatat----gattatatccaaagatttgattaattatgagttactatgaccgatcaaggaacacaacgacgagaat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41554784 |
aagcgcaaatatcgctatggtacttatatatatgattatatccaaagatttgattaattatgagttactatgaccgatcaaggaacacaacgacgagaat |
41554685 |
T |
 |
| Q |
197 |
taattctccaactacttgtgatttttgttaggagctatggtatgtttgttt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41554684 |
taattctccaactacttgtgatttttgttaggagctatggtatgtttgttt |
41554634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University