View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17055_high_7 (Length: 363)
Name: NF17055_high_7
Description: NF17055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17055_high_7 |
 | |
|
| [»] scaffold0148 (1 HSPs) |
| | |
|
| [»] scaffold0280 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0148 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 19 - 351
Target Start/End: Original strand, 28242 - 28574
Alignment:
| Q |
19 |
ggtttaagatgatgaaacggttgtccattgtcttaaaagtgaaatccccactgcttgggtcatcagcacctttccaactagtcagactcaaattcttatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28242 |
ggtttaagatgatgaaacggttgtccattgtcttaaaagtgaaatccccactgcttgggtcatcagcacctttccaactagtcagactcaaattcttatc |
28341 |
T |
|
| Q |
119 |
catattcattccaagtaggaatgtgtcagttggattttcaaagctctcccacagtttcacttccatgagttcatcgtcatataacacaaggttaccagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28342 |
catattcattccaagtaggaatgtgtcagttggattttcaaagctctcccacagtttcacttccatgagttcatcgtcatataaaacaaggttaccagaa |
28441 |
T |
|
| Q |
219 |
tccatgagtttcactgtcctgtttttaggtgaaaaactagaagagtctttgattttggaattggaattagaaaaccagtaccttttttcattaccagatg |
318 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28442 |
tccatgagtttcactgttctgattttaggtgaaaaactagaagagtctttgattttggaactggaattagaaaaccagtaccttttttcattaccggatg |
28541 |
T |
|
| Q |
319 |
tgtctaaaactacgagattcccatcctatgcta |
351 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
28542 |
tgtctaaaactacgagattcccatcctctgcta |
28574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 197 - 249
Target Start/End: Original strand, 3615 - 3667
Alignment:
| Q |
197 |
atataacacaaggttaccagaatccatgagtttcactgtcctgtttttaggtg |
249 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3615 |
atataacacaagattaccagaatccatgagtttcaccgtcctgtttttaggtg |
3667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University