View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17055_low_13 (Length: 300)
Name: NF17055_low_13
Description: NF17055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17055_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 37953917 - 37953635
Alignment:
| Q |
1 |
cataggacagaccttcgtagtcgtggccaccacttcggattcgaatctgcatgtcatggcgttgggaacaaattacagtggcttgaatttctggtacttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37953917 |
cataggacagaccttcgtagtcgtggccaccacttcggattcgaatctgcatgtcatggcgtcgggaacaaattacagtggcttgaatttctggtacttc |
37953818 |
T |
 |
| Q |
101 |
aagaggtatcacaatgacaaggggttttgcagttgtgttggatgtgaatctaaggttttgaacagaaaaccggagtatagatgagtatgaggagtgtgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37953817 |
aagaggtatcacaatgacaaggggttttgcagttgtgttggatgtgaatctaaggttttgaacagaaaaccggagtatagatgagtatgaggagtgtgtt |
37953718 |
T |
 |
| Q |
201 |
tgggtgtacacaaactttgagactgaagtggaattatgattagaataactttcaaggcattgaatgaagctttcatgattatt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37953717 |
tgggtgtacacaaactttgagactgaagtggaattatgattagaataactttcaaggcattgaatgaagctttcatgattatt |
37953635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 38062199 - 38062273
Alignment:
| Q |
1 |
cataggacagaccttcgtagtcgtggccaccacttcggattcgaatctgcatgtcatggcgttgggaacaaatta |
75 |
Q |
| |
|
|||||||| |||| ||| |||||||||| || ||||||||||||||||||| |||||| | ||||||||| |||| |
|
|
| T |
38062199 |
cataggaccgaccctcgaagtcgtggccgccgcttcggattcgaatctgcaggtcatgtctttgggaacagatta |
38062273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 4 - 75
Target Start/End: Complemental strand, 38072580 - 38072509
Alignment:
| Q |
4 |
aggacagaccttcgtagtcgtggccaccacttcggattcgaatctgcatgtcatggcgttgggaacaaatta |
75 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||| || |||||||| |||||| ||||| |||||||||| |||| |
|
|
| T |
38072580 |
aggagagaccctcgaagtcgtggccaccactacgaattcgaatttgcatgccatggtgttgggaacagatta |
38072509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University