View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17055_low_19 (Length: 254)
Name: NF17055_low_19
Description: NF17055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17055_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 14267267 - 14267489
Alignment:
| Q |
20 |
atttattatcaaaatatcttatcgtgaatgttaagaatatattattacacatgtgaaaattaaaagagagatcgaaaggcatcacaacttttccatgtaa |
119 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14267267 |
atttattatcaaaatatctcatcgtaaatgttaagaatatattattacacatgtgaaaattaaaagagagatcgaaaggcatcacaacttttccatgtaa |
14267366 |
T |
 |
| Q |
120 |
caagttatacataaatttatactataaacccaaaatgaggaggatgactccctatgatcctgtatgtatgtgtaagtatggcaacggtgtgaagacaagt |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14267367 |
caagttatgcataaatttatactataaacccaaaatgaggtgaatgactctctatgatcctgtatgta--tgtaagtatggcaacggtgtgaagacaagt |
14267464 |
T |
 |
| Q |
220 |
ttttcctctcttatcctcacctttg |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
14267465 |
ttttcctctcttatcctcacctttg |
14267489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University