View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17055_low_27 (Length: 236)
Name: NF17055_low_27
Description: NF17055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17055_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 42165828 - 42165626
Alignment:
| Q |
18 |
tacttcggaggaggtgccttacggtataagtaaagatacaagtcaattcacacttannnnnnnnnnnnnnnn--aggggaattgccacacttattctcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42165828 |
tacttcggaggaggtgccttacggtataagtaaagatagaagtcaattcacacttatttatttttattttttttaggggaattgccacacttattctcat |
42165729 |
T |
 |
| Q |
116 |
nnnnnnnnntgaagaattaagctaacaaatctactctcacttgtgtttaaccaataacacaaacctttcttcaaaatatctacttaaatgtgtggatatt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42165728 |
aaaaaaaaatgaagaattaagctaacaaatctactctcacttgtttttaaccaataacacaaacctttcttcaaaatatctacttaaatttgtggatatt |
42165629 |
T |
 |
| Q |
216 |
tac |
218 |
Q |
| |
|
||| |
|
|
| T |
42165628 |
tac |
42165626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University