View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17056_high_17 (Length: 204)
Name: NF17056_high_17
Description: NF17056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17056_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 4301717 - 4301530
Alignment:
| Q |
1 |
gtatctagcaaaactcaagacatacacttcagaattggcttcatcaatgtcttcagaatcatctttcttggaatttgacttatgttcctttcgtgaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4301717 |
gtatctagcaaaactcaagacatacacttcagaattggcttcatcaatgtcttcagaatcatctttcttggaatttgacttatgttcctttcgtgaaaca |
4301618 |
T |
 |
| Q |
101 |
taaccattggtggctttgattgatttctcaactgatgatgcaatgaatggtctccaaactaatttaaccatgaaacacacccgttttg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4301617 |
taaccattggtggctttgattgatttctcaactgatgatgcaatgaatggtctccaaactaatttaaccatgaaacacacccgttttg |
4301530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 27 - 150
Target Start/End: Original strand, 33959044 - 33959167
Alignment:
| Q |
27 |
cttcagaattggcttcatcaatgtcttcagaatcatctttcttggaatttgacttatgttcctttcgtgaaacataaccattggtggctttgattgattt |
126 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||| ||| | |||||||||||| |||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
33959044 |
cttcagacttggcttcatctatgtcttcagaatcatcttgctttgtatttgacttatgctcctttcgtgaaacataaccattgtttgctttgattgattt |
33959143 |
T |
 |
| Q |
127 |
ctcaactgatgatgcaatgaatgg |
150 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33959144 |
ctcaactgatgatgcaatgaatgg |
33959167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University