View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17057_low_3 (Length: 231)
Name: NF17057_low_3
Description: NF17057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17057_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 35130149 - 35130278
Alignment:
| Q |
1 |
ttctctatatgcttctgcatgtttcgttgatttactcaatgaatattccaagtggaaattgcatccggaaaaccccatgaccaaaatgtctgacaacaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35130149 |
ttctctatatgcttctgcatgtttcgttgatttactcaatgaatattccaagtggaaattgcatctggaaaaccccatgaccaaaatgtctgacaacaaa |
35130248 |
T |
 |
| Q |
101 |
aattgtaaattttcaatagccttgcatttc |
130 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |
|
|
| T |
35130249 |
aattgtaaattttcaatagctttgcatttc |
35130278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 7 - 130
Target Start/End: Original strand, 35137371 - 35137494
Alignment:
| Q |
7 |
atatgcttctgcatgtttcgttgatttactcaatgaatattccaagtggaaattgcatccggaaaaccccatgaccaaaatgtctgacaacaaaaattgt |
106 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||| ||| || ||| ||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35137371 |
atatgcttgggcatgtttcattgatttactcaatgaatactccttgtagaagttgcatctggaaaaccccataaccaaaatgtctgacaacaaaaattgt |
35137470 |
T |
 |
| Q |
107 |
aaattttcaatagccttgcatttc |
130 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35137471 |
aaattttcaatagccttgcatttc |
35137494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 168 - 219
Target Start/End: Original strand, 35137723 - 35137774
Alignment:
| Q |
168 |
tagttagatatctatttatgaaacattaccattatctttgcatgagcaatga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35137723 |
tagttagatatctatttatgaaacattaccattatctttgcatgagcaatga |
35137774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 168 - 218
Target Start/End: Original strand, 35130314 - 35130364
Alignment:
| Q |
168 |
tagttagatatctatttatgaaacattaccattatctttgcatgagcaatg |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
35130314 |
tagttagatatctattaatgaaacattaccactatctttgcatgagcaatg |
35130364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University