View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17059_high_10 (Length: 307)
Name: NF17059_high_10
Description: NF17059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17059_high_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 57 - 307
Target Start/End: Complemental strand, 45383649 - 45383399
Alignment:
| Q |
57 |
gttccggaccgaaaccaagctcaatccttaatgaagtctactacagaggcgcatggtaggacaccgtactgctagcatgtctgagtgtatccgtccaaca |
156 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45383649 |
gttccggaccgaacccaagctcaatccttaatgaagtctactacagaggcgcatggtaggacaccatactgctagcatgtctgagtgtatccgtccaaca |
45383550 |
T |
 |
| Q |
157 |
atcaatcagcacacacataatcaacataagatgttgttccgcgaaccatgcagagaatctctcaacggcctcaacgaaattttgctcaattctcttgaaa |
256 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45383549 |
atcaatcagcacgcacataatcaacataagatgttgttccgcgaaccatgcagagaatctctcaacggcctcaacgaatttttgctcaattctcttgaaa |
45383450 |
T |
 |
| Q |
257 |
cactacctataaaaggacacctcagctaggataaacatacacattccatta |
307 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45383449 |
ctctacctataaaaggacacctcagctaggataaacatacacattccatta |
45383399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University