View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17059_low_9 (Length: 398)
Name: NF17059_low_9
Description: NF17059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17059_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 19 - 388
Target Start/End: Complemental strand, 2335547 - 2335178
Alignment:
| Q |
19 |
gggcggggaatttatggtttaatgcgggggtggttaagaaagttagaaatagatgtaatattagttttcggaaggtggtgtggaaaggggaggtaccgtt |
118 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2335547 |
gggcggggcatttatggtttaatgcggaggtggttaagaaagttagaaatagatgtaatattagtttttggaaggtggtgtggaaaggggaggtaccgtt |
2335448 |
T |
 |
| Q |
119 |
catacataaatatccgagactttttgctatgtttaatcaacaagaggtaacggtggatgagatgtggaataatgacataaccggtggagttggggccttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2335447 |
catacataaatatccgagactttttgctatgttcaatcaacaagaggtaacggtggatgagatgtggaataatgacataaccggtggagttggggccttg |
2335348 |
T |
 |
| Q |
219 |
tttggaggcgtcaatattttgattgggaaaacgacattttcattaatttattgcaagatttaggaaattttgtgaggcatctatatcttgataagtggag |
318 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2335347 |
tttggaggtgtcaatattttgattgggaaaacgatattttcattaatttattgcaagatttaggaaattttgtgaggcatctatatcttgataagtggag |
2335248 |
T |
 |
| Q |
319 |
ttggagtttagaggaagatgaattatttttcgttgaagtcgatgtataataaattggaagacttgttgct |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2335247 |
ttggagtttagaggaagatgaattatttttcgttgaagtcgatgtataacaaattggaagacttgttgct |
2335178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University