View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_high_113 (Length: 227)
Name: NF1705_high_113
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_high_113 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 210
Target Start/End: Original strand, 36220633 - 36220834
Alignment:
| Q |
9 |
gaagcaaaggaacactgtattctggcaaaacgaaactttgacccgagcaacagtttttaagagaggtctgaacctcctagtgagttggcaaaatgcctag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36220633 |
gaagcaaaggaacactgtattctggcaaaatgaaactttgacccgagcaacagtttttaagagaggtctgaacctcctagtgagttggcaaaatgcctag |
36220732 |
T |
 |
| Q |
109 |
gaaagctgcaatagagtggctatacagcaactacaaatcgacaacacagtttggaggaaaccaagtacaagttgttacaaaagtgatgtctatgttgctt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36220733 |
gaaagctgcaatagagtggctatacagcaactacaaatcgacaacacagtttggaggaaaccaagtacaagttgttacaaaagtgatgtctatgttgctt |
36220832 |
T |
 |
| Q |
209 |
tt |
210 |
Q |
| |
|
|| |
|
|
| T |
36220833 |
tt |
36220834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University