View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_high_38 (Length: 374)
Name: NF1705_high_38
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 29458776 - 29459047
Alignment:
| Q |
1 |
gaaactacgaggcaacgaaagtgaattgttgaatacgattaagttgatttctataggagacttgttgtatgttcataatccgtcagaaccagaagagatg |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29458776 |
gaaactacgaggcaacaaaagtgaattgttgaatacgattaagttgatttctataggagacttgttgtttgttcataatccgtcagaaccagaagagatg |
29458875 |
T |
 |
| Q |
101 |
gtggcgtgtgaggtttcaaaaacaggagggtgtgagtggtggagcgtgagaaatgcagtggtgaatgatgagacaaaaatgggaagaattgtattgtgcg |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29458876 |
gtggcgtgtgaggtttcaaaaaaaggagggtgtgagtggtggagcgtgagaaatgcagtggtgaatgatgagacaaaaatgggaagaattgtattgtgcg |
29458975 |
T |
 |
| Q |
201 |
ccggtgatgtgtgtttggaggatttaaagagcgcggttttaagggattgtaaatttgaattgaaacaactat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29458976 |
ccggtgatgtgtgtttggaggatttaaagagcgcggttttaagggattgtaaatttgaattgaaacaactat |
29459047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University