View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_high_41 (Length: 368)
Name: NF1705_high_41
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_high_41 |
 |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 7 - 357
Target Start/End: Complemental strand, 30190 - 29840
Alignment:
| Q |
7 |
cttcttccaattcttcaggtaaagataaaactgagattaagatgaatgaataacatgatcttccctttctctattcttattttaaacactgatgaattta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30190 |
cttcttccaattcttcaggtaaagataaaactgagattaagatgaatgaataacatgatcttccttttctctattcttattttaaacactgatgaagtta |
30091 |
T |
 |
| Q |
107 |
ctatcaaatttcaggcaagtcatgttgatttttacatgaatgggcatgatcactgtcttgaacatatcagtgatttaagcaggtaaacattaaatgaaag |
206 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30090 |
ctatcaaatttcaggcaaatcatgttgatttttacatgaatgggcatgatcactgtcttgaacatatcagtgatttaagcaggtaaacattaaatgaaag |
29991 |
T |
 |
| Q |
207 |
catataaagtttaattttaattttgatcaatcaatcatagatcatgtgcatgatatcttaaggtagttaagaacaaaattaaatattttgtttaaatttg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29990 |
catataaagtttaattttaattttgatcaatcaattatagatcatgggcatgatattttaaggcagttaagaacaaaattaaatattttatttaaattta |
29891 |
T |
 |
| Q |
307 |
acaattatgattgatcaataatataaacttttctttatattgacgattcat |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29890 |
acaattatgattgatcaataatataaacttttctttatattgacgattcat |
29840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University