View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_high_48 (Length: 341)
Name: NF1705_high_48
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_high_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 18 - 334
Target Start/End: Original strand, 38929054 - 38929370
Alignment:
| Q |
18 |
ggaaatgaaaaccaagtgaagatggtctttaattttaacctaaaagttgaagacttttagcataaagtttatttaatttgaagatgattgcgtcataggt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38929054 |
ggaaatgaaaaccaagtgaagatggtctttaattttaacctaaaagttgaagacttttagcataaagtttatttaatttgaagatgattgcgtcacaggt |
38929153 |
T |
 |
| Q |
118 |
ttgtttcattaggtatgggaatatgcgtatggcattgaattcattcatgagctgtgtttttcatatttagaaacaatgttgtgcaaatcaacctttgatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38929154 |
ttgtttcattaggtatgggaatatgcgtatggcattgaattcattcatgagctgtgtttttcatatttagaaacaatgttgtgcaaatcaacctttgatg |
38929253 |
T |
 |
| Q |
218 |
gattaaataatcatgtattttgggatgatgtgaagatatatgtagcattaaaggggaagcatgaagtaatttacacttttcatcgattcctaattatttc |
317 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38929254 |
gattaaataatcgtgtattttgggatgatatgaagatatatctagcattaaaggggaagcatgaagtaatttacacttttcatcgattcctaattatttc |
38929353 |
T |
 |
| Q |
318 |
aactcaatcggcctatg |
334 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
38929354 |
aactcaatcagcctatg |
38929370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University