View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_high_76 (Length: 272)
Name: NF1705_high_76
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_high_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 70 - 266
Target Start/End: Original strand, 40159378 - 40159574
Alignment:
| Q |
70 |
tacctggttgggttgcgatgatggtgaaggaattagcgtcactcacatgctgctgtgtaagagtgtgaaatgtgttttcgtctttcgcagtgggttttgg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40159378 |
tacctggttgggttgcgatgatggtgaaggaattagcgtcactcacatgctgctgtgtaagagtgtgaaatgtgttttcgtctttcgcagtgggttttgg |
40159477 |
T |
 |
| Q |
170 |
gtttttgggtattacaagggttagggggtgcggctgatggtggtattgggtttttattaggcgctaacttttttgcttgcttccgtgcctttgcttc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40159478 |
gtttttgggtattacaagggttagggggtgcggctgatggtggtattgggtttttattaggcgctaacttttttgcttgcttccgtgccgttgcttc |
40159574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University