View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_high_79 (Length: 264)
Name: NF1705_high_79
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_high_79 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 48441827 - 48441730
Alignment:
| Q |
17 |
atattggtggggatgtgcatgatttgtttgatgatggtggtagtgatcgacttcttgaattgaaagaattgtctcttgatgaattagacatataagct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48441827 |
atattggtggggatgtgcatgatttgtttgatgatggtggtagtgatcgacttcttgaattgaaagaattgtctcttgatgaattagacatataagct |
48441730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 64 - 164
Target Start/End: Complemental strand, 2403369 - 2403269
Alignment:
| Q |
64 |
cgacttcttgaattgaaagaattgtctcttgatgaattagacatataagctatgcttttccggatgatgagaacagggaaatgaagatgatacaactagt |
163 |
Q |
| |
|
||||||||||||||| |||| |||||| ||| ||||||||||||| ||||||| ||||| |||||||||||| || || ||||| || |||||| |||| |
|
|
| T |
2403369 |
cgacttcttgaattggaagagttgtctgttggtgaattagacatagaagctatacttttttggatgatgagaatagagagatgaaaataatacaattagt |
2403270 |
T |
 |
| Q |
164 |
a |
164 |
Q |
| |
|
| |
|
|
| T |
2403269 |
a |
2403269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 99
Target Start/End: Complemental strand, 34126703 - 34126651
Alignment:
| Q |
47 |
atgatggtggtagtgatcgacttcttgaattgaaagaattgtctcttgatgaa |
99 |
Q |
| |
|
|||||| |||| |||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
34126703 |
atgatgatggtggtgagagacttcttgaattgaaagatttgtctcttggtgaa |
34126651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University