View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_106 (Length: 243)
Name: NF1705_low_106
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_106 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 34816809 - 34817031
Alignment:
| Q |
1 |
gtttgacaactgtgagttccttatgcaatatgcgaggtatgttcttgaacttaggagaaatttgttatcaattagcatgcttgttgggttaagccatgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34816809 |
gtttgacaactgtgagttccttatgcaatatgcgacgtatgtttttgaacttaggagaaatttgttatcaattagcatgcttgttgggttaagccatgtc |
34816908 |
T |
|
| Q |
101 |
actagtttcgaacatgggttaatgaaaatttcgcatgatacgaagataaatgcaccaaagtgtgtggttaatacatgttaaatggttgagcgttgctact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34816909 |
actagtttcgaacatgggttaatgaaaattttgcatgatacgaagataaatgcaccacagtgtgtggttaatacatgttaaatggttgagcgttgctact |
34817008 |
T |
|
| Q |
201 |
tggtgcgagaaataacactgcga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34817009 |
tggtgcgagaaataacactgcga |
34817031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 188 - 223
Target Start/End: Complemental strand, 41553100 - 41553065
Alignment:
| Q |
188 |
gagcgttgctacttggtgcgagaaataacactgcga |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41553100 |
gagcattgctacttggtgcgagaaataacactgcga |
41553065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 224
Target Start/End: Original strand, 32518017 - 32518053
Alignment:
| Q |
188 |
gagcgttgctacttggtgcgagaaataacactgcgat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32518017 |
gagcgttgctacttggtgcgagaaataacagtgcgat |
32518053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 217
Target Start/End: Original strand, 14523550 - 14523579
Alignment:
| Q |
188 |
gagcgttgctacttggtgcgagaaataaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14523550 |
gagcgttgctacttggtgcgagaaataaca |
14523579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 217
Target Start/End: Complemental strand, 14477835 - 14477806
Alignment:
| Q |
188 |
gagcgttgctacttggtgcgagaaataaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14477835 |
gagcgttgctacttggtgcgagaaataaca |
14477806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University