View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_108 (Length: 240)
Name: NF1705_low_108
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_108 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 33508664 - 33508717
Alignment:
| Q |
1 |
tcactcatattccctttatcggaggtactaatatttgaagctacacgttggcat |
54 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
33508664 |
tcactcatattccctttattggaggtactaatatttgaagctacaggttggcat |
33508717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 74 - 107
Target Start/End: Original strand, 33508736 - 33508769
Alignment:
| Q |
74 |
gaaataacatgttggcaccttttatattgaactc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
33508736 |
gaaataacatgttggcaccttttatattgtactc |
33508769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University