View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_118 (Length: 234)
Name: NF1705_low_118
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_118 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 55615905 - 55615855
Alignment:
| Q |
1 |
cgggaaagaggatttgatgctggtaattatttacttactgtttacctttgc |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55615905 |
cgggaaagaggatttgatgctggtaattatttacttactgtttacctttgc |
55615855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 55623209 - 55623159
Alignment:
| Q |
1 |
cgggaaagaggatttgatgctggtaattatttacttactgtttacctttgc |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55623209 |
cgggaaagaggatttgatgctggtaattatttacttactgtttacctttgc |
55623159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 221
Target Start/End: Complemental strand, 55630319 - 55630290
Alignment:
| Q |
192 |
attcaagtcatgggatttgtcttgatgttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
55630319 |
attcaagtcatgggatttgtcttgatgttc |
55630290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University