View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1705_low_121 (Length: 230)

Name: NF1705_low_121
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1705_low_121
NF1705_low_121
[»] chr7 (5 HSPs)
chr7 (8-230)||(33399554-33399776)
chr7 (17-228)||(33395672-33395880)
chr7 (13-155)||(33441945-33442087)
chr7 (13-155)||(33452165-33452307)
chr7 (179-230)||(33395571-33395622)


Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 8 - 230
Target Start/End: Complemental strand, 33399776 - 33399554
Alignment:
8 gcagaacctgtgttaacaagtggacatgataaaattgcattgacaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggac 107  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
33399776 gcagcaccagtgttaacaagtggacatgataaaattgcattgacaacctatgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggac 33399677  T
108 aaaagcttttcataaatgttttgccaaaacaagatggttggtatccagcaccctcctcaccttcagcctccccctcaccctcacctgtgccggcccctga 207  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33399676 aaaagcttttcataaatgttttaccaaaacaagatggttggtatccagcaccctcctcaccttcagcctccccctcaccctcacctgtgccggcccctga 33399577  T
208 agcagcaccgccttcaaatgcac 230  Q
    |||||||||||||||||||||||    
33399576 agcagcaccgccttcaaatgcac 33399554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 17 - 228
Target Start/End: Complemental strand, 33395880 - 33395672
Alignment:
17 gtgttaacaagtggacatgataaaattgcattgacaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaagcttt 116  Q
    |||||||| ||||||||||||| ||||  ||||||||||| ||| |||||||||||||||||||||| |||  |||||||| |   ||| ||||||||||    
33395880 gtgttaactagtggacatgatacaattttattgacaacctatggaagaagatggtacatttcaggtgctgctcatcactgcaatcttggccaaaagcttt 33395781  T
117 tcataaatgttttgccaaaacaagatggttggtatccagcaccctcctcaccttcagcctccccctcaccctcacctgtgccggcccctgaagcagcacc 216  Q
    ||||||| ||   ||||  |||   |||||||| ||||| ||||||   ||||||||||||||| |||||||||||||||||| | ||||||||||||||    
33395780 tcataaacgtgcagccaccacagtttggttggtctccagtaccctc---accttcagcctccccgtcaccctcacctgtgccgactcctgaagcagcacc 33395684  T
217 gccttcaaatgc 228  Q
     |||||||||||    
33395683 accttcaaatgc 33395672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 13 - 155
Target Start/End: Complemental strand, 33442087 - 33441945
Alignment:
13 acctgtgttaacaagtggacatgataaaattgcattgacaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaag 112  Q
    |||||||||||| ||||| || || ||||||  | | ||||||| |||||||||||||||||||||| ||||| || |||||||||||||||||||||||    
33442087 acctgtgttaaccagtgggcaagacaaaattataattacaacctatgggagaagatggtacatttcaagtgttaccgatcactgcgaaaatggacaaaag 33441988  T
113 cttttcataaatgttttgccaaaacaagatggttggtatccag 155  Q
    |||||||||| |||   |||||||||||||||||||| |||||    
33441987 cttttcataactgtgcagccaaaacaagatggttggtctccag 33441945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 13 - 155
Target Start/End: Complemental strand, 33452307 - 33452165
Alignment:
13 acctgtgttaacaagtggacatgataaaattgcattgacaacctttgggagaagatggtacatttcaggtgttgccaatcactgcgaaaatggacaaaag 112  Q
    |||||||||||| ||||| || || ||||||  | | ||||||| |||||||||||||||||||||| ||||| || |||||||||||||||||||||||    
33452307 acctgtgttaaccagtgggcaagacaaaattataattacaacctatgggagaagatggtacatttcaagtgttaccgatcactgcgaaaatggacaaaag 33452208  T
113 cttttcataaatgttttgccaaaacaagatggttggtatccag 155  Q
    |||||||||| |||   |||||||||||||||||||| |||||    
33452207 cttttcataactgtgcagccaaaacaagatggttggtctccag 33452165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 230
Target Start/End: Complemental strand, 33395622 - 33395571
Alignment:
179 ccctcaccctcacctgtgccggcccctgaagcagcaccgccttcaaatgcac 230  Q
    |||||||||||||||   ||||||| ||||||||||||| ||||||||||||    
33395622 ccctcaccctcacctacaccggcccatgaagcagcaccgtcttcaaatgcac 33395571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University