View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1705_low_128 (Length: 224)

Name: NF1705_low_128
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1705_low_128
NF1705_low_128
[»] chr1 (1 HSPs)
chr1 (7-224)||(45860324-45860541)
[»] chr8 (2 HSPs)
chr8 (7-100)||(27004152-27004245)
chr8 (121-205)||(27004067-27004151)
[»] chr4 (2 HSPs)
chr4 (7-100)||(35536998-35537091)
chr4 (121-205)||(35537092-35537176)


Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 224
Target Start/End: Complemental strand, 45860541 - 45860324
Alignment:
7 cttctaggatctctactggcagtgtcccgtgttcaagatcagtgttttgtgtttaggttaaatggatgacttaggttttctttgttttgatcttcctttt 106  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
45860541 cttctaggatctatactggcagtgtcccgtgttcaagatcagtgttttgtgtttaggttaaatgggtgacttaggttttctttgttttgatcttcctttt 45860442  T
107 tatgctattccttctccccatttagctatgatttccactgtcttggcagcctactaagctacggttttggttgagggatccttggaacctgcgcctattt 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||    
45860441 tatgctattccttctccccatttagctatgatttccactgtcttggcagcctactaagctacggttttggttgagggatccttggaacctgcgccatttt 45860342  T
207 ggattctactcggaccat 224  Q
    ||||||||||||| ||||    
45860341 ggattctactcggcccat 45860324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 7 - 100
Target Start/End: Complemental strand, 27004245 - 27004152
Alignment:
7 cttctaggatctctactggcagtgtcccgtgttcaagatcagtgttttgtgtttaggttaaatggatgacttaggttttctttgttttgatctt 100  Q
    |||||||||||||| |  ||||||| || |||||||| || |||||||||||||||||||||||   | |||||||||||||||||||||||||    
27004245 cttctaggatctcttcccgcagtgtgccatgttcaaggtcggtgttttgtgtttaggttaaatgagaggcttaggttttctttgttttgatctt 27004152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 205
Target Start/End: Complemental strand, 27004151 - 27004067
Alignment:
121 tccccatttagctatgatttccactgtcttggcagcctactaagctacggttttggttgagggatccttggaacctgcgcctatt 205  Q
    |||||||||||||| ||||||  || | | |||| ||||||||||||||||||| |||| || ||||||||||||| ||||||||    
27004151 tccccatttagctaagatttctgctctgtaggcaccctactaagctacggttttagttggggtatccttggaacctacgcctatt 27004067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 35536998 - 35537091
Alignment:
7 cttctaggatctctactggcagtgtcccgtgttcaagatcagtgttttgtgtttaggttaaatggatgacttaggttttctttgttttgatctt 100  Q
    |||||||||||||| |  ||||||| || |||||||| || ||||||||| |||||||||||||   | |||||||||||||||||||||||||    
35536998 cttctaggatctcttcccgcagtgtgccatgttcaaggtcggtgttttgtttttaggttaaatgagaggcttaggttttctttgttttgatctt 35537091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 205
Target Start/End: Original strand, 35537092 - 35537176
Alignment:
121 tccccatttagctatgatttccactgtcttggcagcctactaagctacggttttggttgagggatccttggaacctgcgcctatt 205  Q
    |||||||||||||| ||||||  || | | |||| ||||||||||||||||||| |||| || ||||||||||||| ||||||||    
35537092 tccccatttagctaagatttctgctctgtaggcaccctactaagctacggtttttgttggggtatccttggaacctacgcctatt 35537176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University