View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_128 (Length: 224)
Name: NF1705_low_128
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_128 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 224
Target Start/End: Complemental strand, 45860541 - 45860324
Alignment:
| Q |
7 |
cttctaggatctctactggcagtgtcccgtgttcaagatcagtgttttgtgtttaggttaaatggatgacttaggttttctttgttttgatcttcctttt |
106 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45860541 |
cttctaggatctatactggcagtgtcccgtgttcaagatcagtgttttgtgtttaggttaaatgggtgacttaggttttctttgttttgatcttcctttt |
45860442 |
T |
|
| Q |
107 |
tatgctattccttctccccatttagctatgatttccactgtcttggcagcctactaagctacggttttggttgagggatccttggaacctgcgcctattt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45860441 |
tatgctattccttctccccatttagctatgatttccactgtcttggcagcctactaagctacggttttggttgagggatccttggaacctgcgccatttt |
45860342 |
T |
|
| Q |
207 |
ggattctactcggaccat |
224 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
45860341 |
ggattctactcggcccat |
45860324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 7 - 100
Target Start/End: Complemental strand, 27004245 - 27004152
Alignment:
| Q |
7 |
cttctaggatctctactggcagtgtcccgtgttcaagatcagtgttttgtgtttaggttaaatggatgacttaggttttctttgttttgatctt |
100 |
Q |
| |
|
|||||||||||||| | ||||||| || |||||||| || ||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
27004245 |
cttctaggatctcttcccgcagtgtgccatgttcaaggtcggtgttttgtgtttaggttaaatgagaggcttaggttttctttgttttgatctt |
27004152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 205
Target Start/End: Complemental strand, 27004151 - 27004067
Alignment:
| Q |
121 |
tccccatttagctatgatttccactgtcttggcagcctactaagctacggttttggttgagggatccttggaacctgcgcctatt |
205 |
Q |
| |
|
|||||||||||||| |||||| || | | |||| ||||||||||||||||||| |||| || ||||||||||||| |||||||| |
|
|
| T |
27004151 |
tccccatttagctaagatttctgctctgtaggcaccctactaagctacggttttagttggggtatccttggaacctacgcctatt |
27004067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 35536998 - 35537091
Alignment:
| Q |
7 |
cttctaggatctctactggcagtgtcccgtgttcaagatcagtgttttgtgtttaggttaaatggatgacttaggttttctttgttttgatctt |
100 |
Q |
| |
|
|||||||||||||| | ||||||| || |||||||| || ||||||||| ||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
35536998 |
cttctaggatctcttcccgcagtgtgccatgttcaaggtcggtgttttgtttttaggttaaatgagaggcttaggttttctttgttttgatctt |
35537091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 205
Target Start/End: Original strand, 35537092 - 35537176
Alignment:
| Q |
121 |
tccccatttagctatgatttccactgtcttggcagcctactaagctacggttttggttgagggatccttggaacctgcgcctatt |
205 |
Q |
| |
|
|||||||||||||| |||||| || | | |||| ||||||||||||||||||| |||| || ||||||||||||| |||||||| |
|
|
| T |
35537092 |
tccccatttagctaagatttctgctctgtaggcaccctactaagctacggtttttgttggggtatccttggaacctacgcctatt |
35537176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University