View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_132 (Length: 221)
Name: NF1705_low_132
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_132 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 208
Target Start/End: Complemental strand, 44830247 - 44830052
Alignment:
| Q |
13 |
gcataggcatgggcaacatacgacacattgatcatttattcattatccaacataaaaacattaagacttttgtttgaaaaactgcatggactcggtctat |
112 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44830247 |
gcataggcatgggcaacatatgacacatcgatcatttattcattatccaacataaaaacattaagacttttgtttgaaaaactgcatggactcggtctat |
44830148 |
T |
 |
| Q |
113 |
tgtatgtatatttgatcaacattatatggccgacaaccccacatttcacacactttgcttgacacacaaaaaatactagatagatatgttcctcct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44830147 |
tgtatgtatatttgatcaacattatatggccgacaaccccacatttcacacactttgcttgacacacaaaaaatactagatagatatgttcctcct |
44830052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University