View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_133 (Length: 220)
Name: NF1705_low_133
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_133 |
 |  |
|
| [»] scaffold0562 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (3 HSPs) |
 |  |  |
|
| [»] scaffold0517 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0106 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (2 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 18)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 34995112 - 34995156
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34995112 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
34995156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 152 - 203
Target Start/End: Complemental strand, 20393337 - 20393286
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20393337 |
atttatatttggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
20393286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 159 - 203
Target Start/End: Original strand, 21953203 - 21953247
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21953203 |
ttaggctaaaatatgcttttggtccctgcaaatatagcgaatttg |
21953247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 34998202 - 34998159
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34998202 |
taggctaaaatatgcttttgatccctgcaaatatagcgagtttg |
34998159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 3276363 - 3276408
Alignment:
| Q |
158 |
tttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
3276363 |
tttaggctaaaatatgtttttggtccctgcaaatatagcgaatttg |
3276408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 162 - 204
Target Start/End: Complemental strand, 1974211 - 1974169
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
1974211 |
ggctaaaatatgtttttgatccttgcaaatatagcgaatttga |
1974169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 21165246 - 21165287
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
21165246 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttg |
21165287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 204
Target Start/End: Complemental strand, 17517378 - 17517326
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||| ||||||||||||||||| ||||| ||||||||||||| |||| ||||| |
|
|
| T |
17517378 |
attttttttaggctaaaatatgtttttggtccctgcaaatatggcgagtttga |
17517326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 204
Target Start/End: Original strand, 20895960 - 20896000
Alignment:
| Q |
164 |
ctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
20895960 |
ctaaaatatgtttttggtccctgcaaatatagcgaatttga |
20896000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 3279555 - 3279516
Alignment:
| Q |
165 |
taaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
3279555 |
taaaatatgtttttgatccctgcaaatatagcgagtttga |
3279516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 193
Target Start/End: Complemental strand, 19321139 - 19321100
Alignment:
| Q |
154 |
ttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
19321139 |
ttattttaggctaaaatatggttttggtccctgcaaatat |
19321100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 1972395 - 1972441
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
1972395 |
tttttggctaaaatatgtttttggtccctgcaaataaagcgaatttg |
1972441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 193
Target Start/End: Complemental strand, 19129527 - 19129489
Alignment:
| Q |
155 |
tattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
19129527 |
tattttaggctaaaatatgattttggtccctgcaaatat |
19129489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 203
Target Start/End: Original strand, 20391217 - 20391255
Alignment:
| Q |
165 |
taaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
20391217 |
taaaatatgcttttggtccctgcaaatatagtgaatttg |
20391255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Original strand, 6412212 - 6412249
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
6412212 |
attttaggctaaaatatggttttggtccctgcaaatat |
6412249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 20897556 - 20897515
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
20897556 |
ggctaaaatatggttttggtccctgcaaatatagtgaatttg |
20897515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 1007119 - 1007155
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
1007119 |
ttttaggctaaaatatggttttggtccctgcaaatat |
1007155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Complemental strand, 1890461 - 1890421
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
1890461 |
tttattttaggctaaaatatggttttagtccctgcaaatat |
1890421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 34)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 976772 - 976820
Alignment:
| Q |
154 |
ttattttaggctaaaatatgcttttgatccctgcaaatatagcgaattt |
202 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
976772 |
ttatattaggctaaaatatgcttttgatccctgcaaatatagcgaattt |
976820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 20585708 - 20585662
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
20585708 |
ttttaggctaaaatatgtttttgatccctgcaaatatagcgagtttg |
20585662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 47433871 - 47433826
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
47433871 |
ttaggctaaaatatggttttggtccctgcaaatatagcgaatttga |
47433826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 160 - 204
Target Start/End: Complemental strand, 54437528 - 54437484
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
54437528 |
taggctaaaatatgtttttggtccctgcaaatatagcgaatttga |
54437484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 203
Target Start/End: Complemental strand, 52403189 - 52403142
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||| |||| |
|
|
| T |
52403189 |
attttaggctaaaatatgcttttggtccctgcaaatatggcgagtttg |
52403142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 38505642 - 38505596
Alignment:
| Q |
158 |
tttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||| ||||| |
|
|
| T |
38505642 |
tttaggctaaaatatgcttttgctccctgcaaatatggcgagtttga |
38505596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 46026071 - 46026117
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
46026071 |
ttttaggctaaaatatgtttttggtccctgcaaatatagcgagtttg |
46026117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 198
Target Start/End: Original strand, 4705676 - 4705717
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcga |
198 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4705676 |
tttttggctaaaatatgcttttgatccctgcaaatatggcga |
4705717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 45267306 - 45267347
Alignment:
| Q |
163 |
gctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
45267306 |
gctaaaatatgtttttgatccctgcaaatatagcgagtttga |
45267347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 52708676 - 52708635
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
52708676 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttg |
52708635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 196
Target Start/End: Complemental strand, 45268639 - 45268595
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatatagc |
196 |
Q |
| |
|
|||| ||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
45268639 |
attttttttaggctaaaatatgtttttaatccctgcaaatatagc |
45268595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 39820665 - 39820622
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
39820665 |
taggctaaaatatggttttggtccctgcaaatatagcgagtttg |
39820622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 42446524 - 42446567
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||| |||| |
|
|
| T |
42446524 |
taggctaaaatatgcttttggtccctgcaaatatggcgagtttg |
42446567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 204
Target Start/End: Complemental strand, 44507859 - 44507816
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
44507859 |
aggctaaaatatgattttggtccctgcaaatatagcgagtttga |
44507816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 204
Target Start/End: Complemental strand, 46027477 - 46027434
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
46027477 |
aggctaaaatatacttttggtccctgcaaatatagcgagtttga |
46027434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 156 - 203
Target Start/End: Original strand, 53121296 - 53121343
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||| ||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
53121296 |
atttaaggctaaaatatgtttttggtccctgcaaatatagcgagtttg |
53121343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 193
Target Start/End: Complemental strand, 39132917 - 39132875
Alignment:
| Q |
151 |
catttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
39132917 |
cattttttttaggctaaaatatggttttggtccctgcaaatat |
39132875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 204
Target Start/End: Original strand, 46104343 - 46104385
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
46104343 |
ggctaaaatatgattttggtccctgcaaatatagcgagtttga |
46104385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 152 - 193
Target Start/End: Original strand, 863271 - 863312
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
863271 |
atttattttaggctaaaatatgattttggtccatgcaaatat |
863312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 193
Target Start/End: Original strand, 9603627 - 9603660
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
9603627 |
taggctaaaatatggttttgatccctgcaaatat |
9603660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 9855178 - 9855219
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
9855178 |
ggctaaaatatgattttgatccctgtaaatatagcgagtttg |
9855219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 152 - 193
Target Start/End: Original strand, 12740897 - 12740938
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
12740897 |
attttttttaggctaaaatatggttttggtccctgcaaatat |
12740938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 193
Target Start/End: Complemental strand, 35407792 - 35407759
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
35407792 |
taggctaaaatatggttttgatccctgcaaatat |
35407759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 43641143 - 43641184
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
43641143 |
ggctaaaatatgcttttagtccctgcaaatatagcgagtttg |
43641184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Original strand, 52342189 - 52342226
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
52342189 |
attttaggctaaaatatggttttggtccctgcaaatat |
52342226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 52707533 - 52707578
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||| ||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
52707533 |
ttaggttaaaatatgtttttggtccttgcaaatatagcgaatttga |
52707578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 196
Target Start/End: Original strand, 3416489 - 3416529
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatatagc |
196 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
3416489 |
atttaaggctaaaatatgattttgatccctgtaaatatagc |
3416529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 22508733 - 22508777
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
22508733 |
taggttaaaatatgattttggtccctgcaaatatagcgagtttga |
22508777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 40476222 - 40476262
Alignment:
| Q |
163 |
gctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
40476222 |
gctaaaatatgtttttggtccctgcaaatatagcgagtttg |
40476262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 40545559 - 40545595
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
40545559 |
ttttaggctaaaatatggttttggtccctgcaaatat |
40545595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 43441604 - 43441572
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
43441604 |
aggctaaaatatggttttgatccctgcaaatat |
43441572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 44802549 - 44802517
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
44802549 |
aggctaaaatatgattttgatccctgcaaatat |
44802517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Complemental strand, 47005524 - 47005488
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
47005524 |
ttttaggctaaaatatggttttggtccctgcaaatat |
47005488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Complemental strand, 51550451 - 51550415
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
51550451 |
ttttaggctaaaatatggttttggtccctgcaaatat |
51550415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 25)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 22270941 - 22270984
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22270941 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
22270984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 203
Target Start/End: Original strand, 10717114 - 10717162
Alignment:
| Q |
155 |
tattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
10717114 |
tattttaggctaaaatatgcttttggtccctgcaaatatagcgagtttg |
10717162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 22534782 - 22534740
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22534782 |
aggctaaaatatgcttttgatccctgcaaatatagcgagtttg |
22534740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 203
Target Start/End: Original strand, 38658472 - 38658522
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
38658472 |
tttattttaggctaaaatatgcttctggtccatgcaaatatagcgaatttg |
38658522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 41847250 - 41847197
Alignment:
| Q |
151 |
catttattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||| ||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
41847250 |
cattcattttaggctaaaatatgcttttagtctctgcaaatatagcgaatttga |
41847197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 10718509 - 10718466
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
10718509 |
taggctaaaatatgcttttggtccctgcaaatatagcgagtttg |
10718466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 22272330 - 22272288
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
22272330 |
aggctaaaatatgcttttggtccccgcaaatatagcgaatttg |
22272288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 193
Target Start/End: Original strand, 27117742 - 27117784
Alignment:
| Q |
151 |
catttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
27117742 |
catttattttaggctaaaatatggttttgctccctgcaaatat |
27117784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 36588221 - 36588263
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
36588221 |
aggctaaaatatgcttttggtccctgcaaatatagcgagtttg |
36588263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 38456791 - 38456749
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaattt |
202 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
38456791 |
taggctaaaatatgcttttggtccctgcaaatatagcaaattt |
38456749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 204
Target Start/End: Original strand, 3483627 - 3483675
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
3483627 |
attttagactaaaatatgtttttggtccctgcaaatatagcgagtttga |
3483675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 4182623 - 4182663
Alignment:
| Q |
163 |
gctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
4182623 |
gctaaaatatgcttttggtccctgtaaatatagcgaatttg |
4182663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 45518021 - 45517978
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
45518021 |
taggctaaaatatgcttttggtccctgcaagtatagcgagtttg |
45517978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 10292815 - 10292857
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
10292815 |
aggctaaaatatgattttggtcccttcaaatatagcgaatttg |
10292857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 28998057 - 28998011
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
28998057 |
tttttggctaaaatatgtttttggtccctgcaaatatagcgagtttg |
28998011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Original strand, 29574737 - 29574775
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatag |
195 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
29574737 |
ttttaggctaaaatatgcatttcatccctgcaaatatag |
29574775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 192
Target Start/End: Complemental strand, 30124286 - 30124252
Alignment:
| Q |
158 |
tttaggctaaaatatgcttttgatccctgcaaata |
192 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
30124286 |
tttaggctaaaatatgcttttggtccctgcaaata |
30124252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 297177 - 297137
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
297177 |
ggctaaaatatgctttag-tccctgcaaatatagcgaatttg |
297137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 1420501 - 1420460
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
1420501 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttg |
1420460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 11019863 - 11019826
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
11019863 |
attttaggctaaaatatggttttggtccctgcaaatat |
11019826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 28346764 - 28346727
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
28346764 |
attttaggctaaaatatggttttggtccctgcaaatat |
28346727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 3680802 - 3680770
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3680802 |
aggctaaaatatgattttgatccctgcaaatat |
3680770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 4474045 - 4474013
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
4474045 |
aggctaaaatatggttttgatccctgcaaatat |
4474013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 10337114 - 10337150
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
10337114 |
ttttaggctaaaatatggttttggtccctgcaaatat |
10337150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Original strand, 10872914 - 10872946
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
10872914 |
aggctaaaatatggttttgatccctgcaaatat |
10872946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 9917 - 9963
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9917 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgagtttg |
9963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 30)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 3879081 - 3879127
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3879081 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgagtttg |
3879127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 202
Target Start/End: Original strand, 32697999 - 32698039
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaattt |
202 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32697999 |
ggctaaaatatgattttgatccctgcaaatatagcgaattt |
32698039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 47360988 - 47360949
Alignment:
| Q |
165 |
taaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47360988 |
taaaatatgcttttgatccttgcaaatatagcgaatttga |
47360949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 17371901 - 17371863
Alignment:
| Q |
165 |
taaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17371901 |
taaaatatgcttttgatccctgcaaatataacgaatttg |
17371863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 158 - 204
Target Start/End: Original strand, 19674410 - 19674456
Alignment:
| Q |
158 |
tttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
19674410 |
tttaggctaaaatatgcttttggtccttgcaaatatagcgagtttga |
19674456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 33137288 - 33137246
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
33137288 |
aggctaaaatatgtttttgatccctgcaaatatagcgagtttg |
33137246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 204
Target Start/End: Complemental strand, 29060942 - 29060899
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
29060942 |
aggctaaaatatgtttttaatccctgcaaatatagcgagtttga |
29060899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 38166493 - 38166536
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
38166493 |
taggctaaaatatgtttttaatccctgcaaatatagcgagtttg |
38166536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 203
Target Start/End: Complemental strand, 42359415 - 42359364
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||| |||| |||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
42359415 |
atttttttttggctaaaatatgtttttggtccctgcaaatatagcgagtttg |
42359364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 45618283 - 45618326
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
45618283 |
taggctaatatatgcttttggtccctgcaaatatagcgagtttg |
45618326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 194
Target Start/End: Complemental strand, 13074131 - 13074093
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatata |
194 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
13074131 |
attttaggctaaaatatggttttggtccctgcaaatata |
13074093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 17281570 - 17281612
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
17281570 |
aggctaaaatgtgcttttagtccctgcaaatatagcgaatttg |
17281612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 17370072 - 17370114
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
17370072 |
aggctaaaatgtgcttttagtccctgcaaatatagcgaatttg |
17370114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 193
Target Start/End: Complemental strand, 47023108 - 47023074
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47023108 |
ttaggctaaaatatggttttgatccctgcaaatat |
47023074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 19675679 - 19675638
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
19675679 |
ggctaaaatatgcttttggtccctgcaaatataacgagtttg |
19675638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 22204055 - 22204096
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
22204055 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttg |
22204096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 193
Target Start/End: Complemental strand, 23245597 - 23245564
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
23245597 |
taggctaaaatatggttttgatccctgcaaatat |
23245564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 193
Target Start/End: Original strand, 26412188 - 26412221
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
26412188 |
taggctaaaatatggttttgatccctgcaaatat |
26412221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Original strand, 31811919 - 31811956
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
31811919 |
atttaaggctaaaatatggttttgatccctgcaaatat |
31811956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 193
Target Start/End: Original strand, 33134889 - 33134922
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
33134889 |
taggctaaaatatgtttttgatccctgcaaatat |
33134922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 161 - 198
Target Start/End: Original strand, 34659705 - 34659742
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcga |
198 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
34659705 |
aggctaaaatatgcttttggtccctgcaaatatggcga |
34659742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Original strand, 42823770 - 42823807
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
42823770 |
attttaggctaaaatatgattttggtccctgcaaatat |
42823807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 45619795 - 45619754
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcga |
198 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
45619795 |
ttttaggctaaaatatgtttttagtccctgcaaatatagcga |
45619754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 2322433 - 2322401
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
2322433 |
aggctaaaatatggttttgatccctgcaaatat |
2322401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 14594201 - 14594237
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
14594201 |
ttttaggctaaaatatggttttggtccctgcaaatat |
14594237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 26313983 - 26314019
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
26313983 |
tttttggctaaaatatggttttgatccctgcaaatat |
26314019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 204
Target Start/End: Original strand, 29059703 - 29059755
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
29059703 |
atttattaaaggctaaaatatgtttttcgtccctgcaaatataacgaatttga |
29059755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Original strand, 31560330 - 31560362
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31560330 |
aggctaaaatatggttttgatccctgcaaatat |
31560362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 35464013 - 35464049
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
35464013 |
ttttaggctaaaatatggttttggtccctgcaaatat |
35464049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Original strand, 44925484 - 44925516
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
44925484 |
aggctaaaatatggttttgatccctgcaaatat |
44925516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 25)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 12068406 - 12068364
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaattt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12068406 |
taggctaaaatatgcttttgatccctgcaaatatagcgaattt |
12068364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 25979311 - 25979269
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
25979311 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttg |
25979269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 29794378 - 29794334
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
29794378 |
ttaggctaaaatatg-ttttggtccctgcaaatatagcgaatttga |
29794334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 33575747 - 33575783
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33575747 |
ttttaggctaaaatatggttttgatccctgcaaatat |
33575783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 193
Target Start/End: Complemental strand, 1138363 - 1138328
Alignment:
| Q |
158 |
tttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1138363 |
tttaggctaaaatatggttttgatccctgcaaatat |
1138328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 204
Target Start/End: Original strand, 1777468 - 1777511
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
1777468 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttga |
1777511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 203
Target Start/End: Complemental strand, 1778859 - 1778808
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||| |||||||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
1778859 |
atttatttatggctaaaatatgcttttggttcctgcaaatatagcgactttg |
1778808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 2412489 - 2412446
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
2412489 |
taggctaaaatatgtttttggtccctgcaaatatagcgagtttg |
2412446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 156 - 195
Target Start/End: Original strand, 25977864 - 25977903
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatatag |
195 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
25977864 |
attttaggctaaaatatgtttttggtccctgcaaatatag |
25977903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 193
Target Start/End: Complemental strand, 2481568 - 2481526
Alignment:
| Q |
151 |
catttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||| ||||||||||||| ||||| ||||||||||||| |
|
|
| T |
2481568 |
catttatttaaggctaaaatatggttttggtccctgcaaatat |
2481526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 204
Target Start/End: Complemental strand, 25283331 - 25283289
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
25283331 |
ggctaaaatatgtttttggtcactgcaaatatagcgaatttga |
25283289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 194
Target Start/End: Complemental strand, 33882982 - 33882940
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatata |
194 |
Q |
| |
|
||||||||||| ||||||||||| ||| ||||||||||||||| |
|
|
| T |
33882982 |
atttattttagactaaaatatgcatttcatccctgcaaatata |
33882940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 194
Target Start/End: Original strand, 38231425 - 38231463
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatata |
194 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
38231425 |
atttttggctaaaatatgattttgatccctgcaaatata |
38231463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Original strand, 43236499 - 43236537
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatag |
195 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
43236499 |
ttttaggctaaaatatgcattttatccctgcaaatatag |
43236537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 195
Target Start/End: Original strand, 4038838 - 4038875
Alignment:
| Q |
158 |
tttaggctaaaatatgcttttgatccctgcaaatatag |
195 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
4038838 |
tttaggctaaaatatgattttgatccctgtaaatatag |
4038875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 11087049 - 11087090
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
11087049 |
ggctaaaatatgattttaatccctgcaaatatagcgagtttg |
11087090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Original strand, 24358610 - 24358647
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
24358610 |
attttaggctaaaatatggttttggtccctgcaaatat |
24358647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Original strand, 4042609 - 4042641
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
4042609 |
aggctaaaatatggttttgatccctgcaaatat |
4042641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 14003404 - 14003440
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
14003404 |
ttttaggctaaaatatggttttggtccctgcaaatat |
14003440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 192
Target Start/End: Original strand, 15531023 - 15531059
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaata |
192 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
15531023 |
attttaggctaaaatatgtttttggtccctgcaaata |
15531059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Complemental strand, 17541785 - 17541745
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||||| |
|
|
| T |
17541785 |
tttatttaaggctaaaatatggttttaatccctgcaaatat |
17541745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 20131312 - 20131348
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
20131312 |
ttttaggctaaaatatggttttggtccctgcaaatat |
20131348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 20245367 - 20245323
Alignment:
| Q |
160 |
taggctaaaatatgctttt-gatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||||||||||||||| |
|
|
| T |
20245367 |
taggctaaaatatggtttttgattcctgcaaatatagcgaatttg |
20245323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 24358946 - 24358914
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24358946 |
aggctaaaatatggttttgatccctgcaaatat |
24358914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Original strand, 32476094 - 32476126
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
32476094 |
aggctaaaatatggttttgatccctgcaaatat |
32476126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 34)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 204
Target Start/End: Complemental strand, 24197164 - 24197120
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24197164 |
taggctaaaatatgcttttggtccctgcaaatatagcgaatttga |
24197120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 32197971 - 32197927
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32197971 |
ttaggctaaaatatgcttttggtccctgcaaatatagcgaatttg |
32197927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 17066420 - 17066466
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
17066420 |
ttttaggctaaaatatgcttttaatccctgcaaatatagcgagtttg |
17066466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 204
Target Start/End: Complemental strand, 41695024 - 41694972
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
41695024 |
atttaatttaggctaaaatatgtttttcatccctgcaaatatagcgagtttga |
41694972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 165 - 203
Target Start/End: Original strand, 5610159 - 5610197
Alignment:
| Q |
165 |
taaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5610159 |
taaaatatgcttttgatccctgcaaatataacgaatttg |
5610197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 5611575 - 5611525
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||| |||||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
5611575 |
tttaatttaggctaaaatatgattttggtccctgcaaatatagcgagtttg |
5611525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 41693644 - 41693686
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
41693644 |
aggctaaaatatgtttttgatccctgcaaatatggcgaatttg |
41693686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 12933417 - 12933461
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
12933417 |
taggctaaaatatgcttttggtccctgcaaatatagtgagtttga |
12933461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 193
Target Start/End: Original strand, 25988376 - 25988416
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
25988376 |
tttattttaggctaaaatatggttttggtccctgcaaatat |
25988416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 31848206 - 31848162
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
31848206 |
ttaggctaaaatatgtttttagtccctgcaaatatagcgaatttg |
31848162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 11217127 - 11217088
Alignment:
| Q |
165 |
taaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
11217127 |
taaaatatgcttttggtccctgcaaatatagcgagtttga |
11217088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 193
Target Start/End: Original strand, 20355400 - 20355439
Alignment:
| Q |
154 |
ttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
20355400 |
ttattttaggctaaaatatgattttgatccttgcaaatat |
20355439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 40576764 - 40576807
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
40576764 |
taggctaaaatatgcttttggtccctgcaaatatgacgaatttg |
40576807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 13418949 - 13418991
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||| ||||||||| |
|
|
| T |
13418949 |
aggctaaaatatgtttttggtccctgcaaatattgcgaatttg |
13418991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 24195606 - 24195648
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
24195606 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttg |
24195648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 31695719 - 31695681
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatag |
195 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
31695719 |
ttttaggctaaaatatgcatttcatccctgcaaatatag |
31695681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 31846981 - 31847027
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| | |||||| |
|
|
| T |
31846981 |
ttttaggttaaaatatgcttttggtccctgcaaatatatctaatttg |
31847027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 32544830 - 32544792
Alignment:
| Q |
165 |
taaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
32544830 |
taaaatatgattttggtccctgcaaatatagcgaatttg |
32544792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 152 - 193
Target Start/End: Complemental strand, 11767285 - 11767244
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
11767285 |
attttttttaggctaaaatatggttttggtccctgcaaatat |
11767244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 152 - 193
Target Start/End: Original strand, 23399602 - 23399643
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
23399602 |
attttttttaggctaaaatatggttttggtccctgcaaatat |
23399643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 35470286 - 35470249
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
35470286 |
attttaggctaaaatttggttttgatccctgcaaatat |
35470249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Original strand, 1614550 - 1614590
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
1614550 |
tttattataggctaaaatatggttttggtccctgcaaatat |
1614590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Complemental strand, 3975847 - 3975807
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
3975847 |
tttaatttaggctaaaatatggttttggtccctgcaaatat |
3975807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Complemental strand, 16853598 - 16853558
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
16853598 |
tttatttttggctaaaatatggttttggtccctgcaaatat |
16853558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 32196685 - 32196725
Alignment:
| Q |
163 |
gctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
32196685 |
gctaaaatatgtttttggtccctgcaaatatagcgtatttg |
32196725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 34878126 - 34878094
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
34878126 |
aggctaaaatatggttttgatccctgcaaatat |
34878094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Complemental strand, 35104304 - 35104264
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
35104304 |
tttattttaggctcaaatatggttttggtccctgcaaatat |
35104264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 35210177 - 35210213
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
35210177 |
ttttaggctaaaatatgattttgatcccggcaaatat |
35210213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Complemental strand, 35838342 - 35838306
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
35838342 |
ttttaggctaaaatatggttttggtccctgcaaatat |
35838306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Complemental strand, 41054241 - 41054205
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
41054241 |
ttttaggctaaaatatggttttggtccctgcaaatat |
41054205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 43065999 - 43066043
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
43065999 |
taggttaaaatatgttttttatccctgcaaatatagcgagtttga |
43066043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 44568691 - 44568659
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
44568691 |
aggctaaaatatggttttgatccctgcaaatat |
44568659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 46759653 - 46759689
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
46759653 |
ttttaggctaaaatatggttttggtccctgcaaatat |
46759689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 48854071 - 48854039
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
48854071 |
aggctaaaatatgattttgatccctgcaaatat |
48854039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 3)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 156 - 203
Target Start/End: Complemental strand, 376434 - 376387
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
376434 |
attttaggctaaaatatgcttttggtccctgcaaatatagcgagtttg |
376387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 345959 - 345915
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
345959 |
ttaggctaaaatatgtttttggtccctgcaaatatagcgaatttg |
345915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 374335 - 374376
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
374335 |
ggctaaaatatgattttgatccctgcaaatatagcgagtttg |
374376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 28)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 46073883 - 46073926
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46073883 |
taggctaaaatatgcttttgatccctgcaaatatagcaaatttg |
46073926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 35911948 - 35911906
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35911948 |
aggctaaaatatgcttttggtccctgcaaatatagcgaatttg |
35911906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 204
Target Start/End: Complemental strand, 37396899 - 37396857
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37396899 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttga |
37396857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 34934810 - 34934765
Alignment:
| Q |
158 |
tttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34934810 |
tttaggctaaaatatgctttttgtccctgcaaatatagcgaatttg |
34934765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 160 - 204
Target Start/End: Complemental strand, 48334193 - 48334149
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
48334193 |
taggctaaaatatgcttttggtccctacaaatatagcgaatttga |
48334149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 161 - 204
Target Start/End: Complemental strand, 20723748 - 20723705
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
20723748 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttga |
20723705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 161 - 204
Target Start/End: Complemental strand, 45979556 - 45979513
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
45979556 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttga |
45979513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 9774948 - 9774906
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
9774948 |
aggctaaaatatgcttttggtccctgcaaatatagcgagtttg |
9774906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 11711312 - 11711271
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
11711312 |
ggctaaaatatgtttttggtccctgcaaatatagcgaatttg |
11711271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 20722472 - 20722513
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
20722472 |
ggctaaaatgtgcttttggtccctgcaaatatagcgaatttg |
20722513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 26863853 - 26863902
Alignment:
| Q |
155 |
tattttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||| |||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
26863853 |
tatttaaggctaaaatgtgtttttggtccctgcaaatatagcgaatttga |
26863902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 35722348 - 35722303
Alignment:
| Q |
158 |
tttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||| ||||| |||||| |||||||||||||||| |
|
|
| T |
35722348 |
tttaggctaaaatatgtttttggtccctgtaaatatagcgaatttg |
35722303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 46075109 - 46075068
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
46075109 |
ggctaaaatatgtttttgatccctgcaaatatagcgagtttg |
46075068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 198
Target Start/End: Complemental strand, 39163087 - 39163047
Alignment:
| Q |
158 |
tttaggctaaaatatgcttttgatccctgcaaatatagcga |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
39163087 |
tttaggctaaaatatgcttttggtccctgcaaatatggcga |
39163047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 146 - 193
Target Start/End: Original strand, 15516566 - 15516613
Alignment:
| Q |
146 |
atttccatttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
15516566 |
atttacattgattttaggctaaaatatggttttggtccctgcaaatat |
15516613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 27264277 - 27264234
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
27264277 |
taggctaaaatatgattttggtccctgcaaatatagcgagtttg |
27264234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 193
Target Start/End: Original strand, 33000293 - 33000336
Alignment:
| Q |
150 |
ccatttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
33000293 |
ccatttattttcggctaaaatatggttttggtccctgcaaatat |
33000336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 35721099 - 35721142
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
35721099 |
taggctaaaatatgtttttggtccctgcaaatataacgaatttg |
35721142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 204
Target Start/End: Original strand, 50164402 - 50164445
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||| ||||| |
|
|
| T |
50164402 |
aggctaaaatatgcttttggtccctgcaaatatggcgagtttga |
50164445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 17977619 - 17977577
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||| ||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
17977619 |
aggcttaaatatggttttggtccctgcaaatatagcgaatttg |
17977577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 27262907 - 27262949
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
27262907 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttg |
27262949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 37395632 - 37395674
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
37395632 |
aggctaaaatatgtttttggtccctgcaaatatagcgtatttg |
37395674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 152 - 193
Target Start/End: Original strand, 21391086 - 21391127
Alignment:
| Q |
152 |
atttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
21391086 |
atttattttaggctaaaatatggttttagtccctgcaaatat |
21391127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 30724077 - 30724032
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| | ||||||| |
|
|
| T |
30724077 |
ttaggctaaaatatgcttttcgtccctgcaaatataacaaatttga |
30724032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 161 - 194
Target Start/End: Complemental strand, 31061152 - 31061119
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatata |
194 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
31061152 |
aggctaaaatatggttttgatccctgcaaatata |
31061119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 10887228 - 10887264
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
10887228 |
ttttaggctaaaatatggttttggtccctgcaaatat |
10887264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 198
Target Start/End: Complemental strand, 23470028 - 23469992
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcga |
198 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
23470028 |
ggctaaaatatgtttttggtccctgcaaatatagcga |
23469992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 48153043 - 48153011
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
48153043 |
aggctaaaatatgcttttgctccctgcaaatat |
48153011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 204
Target Start/End: Original strand, 10315 - 10357
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10315 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttga |
10357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 11582 - 11540
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
11582 |
aggctaaaatatgtttttggtccctgcaaatatagcgtatttg |
11540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 204
Target Start/End: Original strand, 119593 - 119635
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttga |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
119593 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttga |
119635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 121044 - 121003
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
121044 |
ggctaaaatatgcttttggtccctgcaaatataacgagtttg |
121003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 19)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 203
Target Start/End: Original strand, 15599762 - 15599806
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
15599762 |
ttaggctaaaatatgcttttggtccctacaaatatggcgaatttg |
15599806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 203
Target Start/End: Original strand, 31540493 - 31540537
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
31540493 |
ttaggctaaaatatgtttttggtccctgcaaatataacgaatttg |
31540537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 162 - 202
Target Start/End: Complemental strand, 31541681 - 31541641
Alignment:
| Q |
162 |
ggctaaaatatgcttttgatccctgcaaatatagcgaattt |
202 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
31541681 |
ggctaaaatatgtttttgatccctgcaaatataacgaattt |
31541641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 36278076 - 36278112
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36278076 |
ttttaggctaaaatatggttttgatccctgcaaatat |
36278112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 203
Target Start/End: Original strand, 14809165 - 14809204
Alignment:
| Q |
164 |
ctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
14809165 |
ctaaaatatgtttttgatccctacaaatatagcgaatttg |
14809204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 3936577 - 3936619
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
3936577 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttg |
3936619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 198
Target Start/End: Original strand, 25252635 - 25252677
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatatagcga |
198 |
Q |
| |
|
||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
25252635 |
atttttggctaaaatatgtttttgatctctgcaaatatagcga |
25252677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 198
Target Start/End: Original strand, 25316420 - 25316462
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatatagcga |
198 |
Q |
| |
|
||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
25316420 |
atttttggctaaaatatgtttttgatctctgcaaatatagcga |
25316462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 27571189 - 27571147
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
27571189 |
aggctaaaatatgattttggtccctgcaaatatagcgagtttg |
27571147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 34911888 - 34911846
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
34911888 |
aggctaaaatatgattttggtccctgcaaatatagcgagtttg |
34911846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 193
Target Start/End: Original strand, 38554748 - 38554782
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38554748 |
ttaggctaaaatatggttttgatccctgcaaatat |
38554782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 164 - 193
Target Start/End: Complemental strand, 3205159 - 3205130
Alignment:
| Q |
164 |
ctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3205159 |
ctaaaatatgcttttgatccctgcaaatat |
3205130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 19565837 - 19565800
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
19565837 |
attttaggctaaaatatggttttggtccctgcaaatat |
19565800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 35877058 - 35877021
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
35877058 |
attttaggctaaaatatggttttggtccctgcaaatat |
35877021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 193
Target Start/End: Original strand, 40038492 - 40038525
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
40038492 |
taggctaaaatatggttttgatccctgcaaatat |
40038525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 196
Target Start/End: Complemental strand, 3938121 - 3938085
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagc |
196 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3938121 |
taggctaaaatatgcttttagtccctgcaaatatagc |
3938085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 203
Target Start/End: Original strand, 3954049 - 3954093
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||| ||||| ||| |||||||||| |||||||| |
|
|
| T |
3954049 |
ttaggctaaaatatgtttttggtccttgcaaatatatcgaatttg |
3954093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 196
Target Start/End: Complemental strand, 27459551 - 27459515
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatatagc |
196 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
27459551 |
taggctaaaatatgcttttaatccttgcaaatatagc |
27459515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Original strand, 40764406 - 40764446
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||||||||||| |
|
|
| T |
40764406 |
tttatttaaggctaaaatatggttttggtccctgcaaatat |
40764446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Original strand, 202578 - 202620
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatatagcgaatttg |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
202578 |
aggctaaaatatgcttttggtccctgcaaatataacgagtttg |
202620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 192
Target Start/End: Original strand, 29726 - 29759
Alignment:
| Q |
159 |
ttaggctaaaatatgcttttgatccctgcaaata |
192 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
29726 |
ttaggctaaaatatgcttttggtccctgcaaata |
29759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 193
Target Start/End: Original strand, 75353 - 75390
Alignment:
| Q |
156 |
attttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
75353 |
attttaggctaaaatatggttttgctccctgcaaatat |
75390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 193
Target Start/End: Original strand, 2499 - 2532
Alignment:
| Q |
160 |
taggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
2499 |
taggctaaaatatggttttgatccctgcaaatat |
2532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Complemental strand, 2665 - 2629
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
2665 |
ttttaggctaaaatatggttttggtccctgcaaatat |
2629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Original strand, 4032 - 4072
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
4032 |
tttattttaggctaaaatatggttttagtccctgcaaatat |
4072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Original strand, 19214 - 19254
Alignment:
| Q |
153 |
tttattttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
19214 |
tttattttaggctaaaatatggttttagtccctgcaaatat |
19254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Original strand, 21695 - 21727
Alignment:
| Q |
161 |
aggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
21695 |
aggctaaaatatggttttgatccctgcaaatat |
21727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Complemental strand, 223177 - 223141
Alignment:
| Q |
157 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
193 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
223177 |
ttttaggctaaaatatggttttggtccctgcaaatat |
223141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University