View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_136 (Length: 212)
Name: NF1705_low_136
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_136 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 113 - 191
Target Start/End: Complemental strand, 40319263 - 40319181
Alignment:
| Q |
113 |
aaagataaaagactcctacaaactgaaataaaatttata----ctactcatgacgcacttgaatcaatctctaaatgtgatta |
191 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40319263 |
aaagataaaagactccaacaaactgaaataaagtttatatatactactcatgacgcacttgaatcaatctctaaatgtgatta |
40319181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University