View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_24 (Length: 419)
Name: NF1705_low_24
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 8 - 402
Target Start/End: Original strand, 41357269 - 41357664
Alignment:
| Q |
8 |
ccaagaatatgattgtttctgtggcattttctatttccattagcaactcttctttcaacggca-gaaattgaccaagagatggaggattatttttctgat |
106 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41357269 |
ccaaaaatatgattgtttctgtggctttttctatttccattagcaactcttctttcaacggcaagaaattgaccaagagatggaggattacttttctgat |
41357368 |
T |
|
| Q |
107 |
tatgagcaacttcagcttctctagttctgcttgagcatagacagagtaagcatgagctgaatttgaacttgttatgatctttcttgcttttgaacatatc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41357369 |
tatgagcaacttcagcttctctagttctgcttgagcatagacagagtaagcatgagctgaatttgaacttgttatgatctttcttgcttttgaacatttc |
41357468 |
T |
|
| Q |
207 |
tgttttggttcctcttattgatcttctagatagctctacaatgctattgactcccattaggctcccaagtgtggtacttttgtctaggaaaaatgacccc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41357469 |
tgttttggttcctcttattgatcttctagatagctctacaatgctattgactcccattaggctcccaagtgtggtacttttgtctaggaaaaatgacccc |
41357568 |
T |
|
| Q |
307 |
gtggactgaattaaaagatacatgacaaaaattaggaacattgtaagacaatgtcaccataatataagaaaaaagaagaaagtcaaatgcaaattt |
402 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41357569 |
gcggactgaattaaaagatacatgacaaaaattaggaacattgtaagacaatgtcaccataatataagaaaaaagaagaaagtcaaatgcaaattt |
41357664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University