View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1705_low_42 (Length: 373)

Name: NF1705_low_42
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1705_low_42
NF1705_low_42
[»] chr2 (2 HSPs)
chr2 (66-202)||(12116113-12116249)
chr2 (199-241)||(12116416-12116458)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 66 - 202
Target Start/End: Original strand, 12116113 - 12116249
Alignment:
66 catagcatgcgtgaccaaaagtaacatcaaccatgaaaatcagaaagaaatatttttgtctgtacaaatatcggaaagttatgttggacattgactaatc 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
12116113 catagcatgcgtgaccaaaagtaacatcaaccatgaaaatcagaaagaaatatttttgtctgtacaaatatcggaaagttatgttggatattgactaatc 12116212  T
166 taaattgagctgagtcactgtcttttctatatttaca 202  Q
    ||||||||||||| || ||||||||| ||||||||||    
12116213 taaattgagctgactcgctgtcttttttatatttaca 12116249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 12116416 - 12116458
Alignment:
199 tacaaaactcaaattcaattcattacacattgaaaccaaactg 241  Q
    |||||||||||||||||| ||||||||| ||||||||||||||    
12116416 tacaaaactcaaattcaaatcattacacgttgaaaccaaactg 12116458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University