View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_42 (Length: 373)
Name: NF1705_low_42
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 66 - 202
Target Start/End: Original strand, 12116113 - 12116249
Alignment:
| Q |
66 |
catagcatgcgtgaccaaaagtaacatcaaccatgaaaatcagaaagaaatatttttgtctgtacaaatatcggaaagttatgttggacattgactaatc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12116113 |
catagcatgcgtgaccaaaagtaacatcaaccatgaaaatcagaaagaaatatttttgtctgtacaaatatcggaaagttatgttggatattgactaatc |
12116212 |
T |
|
| Q |
166 |
taaattgagctgagtcactgtcttttctatatttaca |
202 |
Q |
| |
|
||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
12116213 |
taaattgagctgactcgctgtcttttttatatttaca |
12116249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 12116416 - 12116458
Alignment:
| Q |
199 |
tacaaaactcaaattcaattcattacacattgaaaccaaactg |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
12116416 |
tacaaaactcaaattcaaatcattacacgttgaaaccaaactg |
12116458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University