View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_56 (Length: 326)
Name: NF1705_low_56
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 58 - 311
Target Start/End: Original strand, 43172369 - 43172623
Alignment:
| Q |
58 |
atgaagagcacaaactttgccactcttttctttggatgcttttgaccaaacctcacatgaagctttatccacaaataggaatggttttgacaaaagggcg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43172369 |
atgaagagcacaaactttgccactcttttctttggatgcttttgaccaaacctcacatgaagctttatccacaaataggaatggttttgacaaaagggcg |
43172468 |
T |
 |
| Q |
158 |
tttgtaaaactaaataagaagataagttggatttgctta-agtggatttgggtggttcttgttggcaatgaaagtgcagggtagctagtgaccactagtg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43172469 |
tttgtaaaactaaataagaagataagttggatttgcttagagtggatttgggtggttcttgttggcaatgaaagtgcagggtagttagtgaccactagtg |
43172568 |
T |
 |
| Q |
257 |
gtacatacagactcacatagtcagtgacatggttattatgcaaaactttgatttt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43172569 |
gtacatacagactcacatagtcagtgacatggttattatgcaaaactttgatttt |
43172623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 258
Target Start/End: Complemental strand, 36643313 - 36643247
Alignment:
| Q |
189 |
tttgctta-agtggatttgggtggttcttgttggcaatgaaagtgcagggtagctagtgaccactagtggt |
258 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
36643313 |
tttgcttagagttgatttgggtggttcttgttggcaatgaaagtgcagtg----tagtgaccactagtggt |
36643247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 85 - 155
Target Start/End: Complemental strand, 36643447 - 36643377
Alignment:
| Q |
85 |
ttctttggatgcttttgaccaaacctcacatgaagctttatccacaaataggaatggttttgacaaaaggg |
155 |
Q |
| |
|
|||||||||||| | ||| | || ||| ||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
36643447 |
ttctttggatgcatctgaacccacttcagatgaagctttaaccacataaaggaatggttttgacaaaaggg |
36643377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University