View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_61 (Length: 317)
Name: NF1705_low_61
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_61 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 18 - 317
Target Start/End: Complemental strand, 9839727 - 9839428
Alignment:
| Q |
18 |
catgtttggtgtttgtgtggcatactacttatgactattagtaatttgatttattttgcagaaatacatgaagatgagaaatacttacattcatctactg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9839727 |
catgtttggtgtttgtgtggcatactacttatgactattagtaatttgatttattttgcagaaatacatgaagatgagaaatacttacattcatctactg |
9839628 |
T |
 |
| Q |
118 |
gttgagttaacagaggtaacgactttttcgatgatggtttaaagacaaaagacactattgttttggatagtctcccaaatatctttgttttggttggcca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9839627 |
gttgagttaacagaggtaacgactttttcgaagatggtttaaagacaaaagacactattgttttggatagtctcccaaatatctttgttttggttggcca |
9839528 |
T |
 |
| Q |
218 |
gcagtttgaccccaaatgcaagctcacacaaatggtagagtaaaaatgcttttgctactagcgtaatttagtgcatagtcttttcagaatccagaataat |
317 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9839527 |
gcagtttgacctcaaatgcaagctcacacaaatggtacagtaaaaatgcttttgctactagcgtaatttagtgcatagtcttttcagaatccataataat |
9839428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University