View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_66 (Length: 304)
Name: NF1705_low_66
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 16590899 - 16590609
Alignment:
| Q |
1 |
aaaattcaactctgagaatgaatctttgattatgaatgaatacacattgaaacccaatcctcttcatcctttaagagtttgatttagtat--gaatatga |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16590899 |
aaaattcaactctgagaatgaatctttgattatgaatgaatacacattgaaacccaatcctcttcatcctttaagagtttgatttagtatatgaatatga |
16590800 |
T |
 |
| Q |
99 |
agaccaatattgattctagatcataatcactagctattttataacatatctattttgactataaaaacaattttgatgtgaggtaagctaacccttcaaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16590799 |
agaccaatattgattctagatcataatcactagctattttataacatatctattttgactataaaaacaattttgatgtgaggtaagctaatccttcaaa |
16590700 |
T |
 |
| Q |
199 |
gtataacttctaacaaattgtgtggtgccacaatttagtataacttgttatttttaataataaatttatgtttatagtttcacaatttagt |
289 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16590699 |
gtataacttctaacaaattgtgtggtgtcacaatttagtataacttgttatttttaataataaatttatgtttatagtttcacaatttagt |
16590609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University