View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_80 (Length: 275)
Name: NF1705_low_80
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_80 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 10 - 264
Target Start/End: Complemental strand, 47036650 - 47036396
Alignment:
| Q |
10 |
attatactagaaacaaaattttgcaaagaccaaaagcccctaaaaaatgcagcaactttttggtcagcaaactagtcgtatgtaactcatatttggcaaa |
109 |
Q |
| |
|
|||| ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036650 |
attaaactagaaccaaaattttgcaaagacaaaaagcccctaaaaaatgcagcaactttttggtcagcaaactagtcgtatgtaactcatatttggcaaa |
47036551 |
T |
 |
| Q |
110 |
aacatcgatagcttgatctccttcatcatgtagtaaaccagcaaaaacaattttctgatgcagtaaagtgggacaaatttactctccctagaaatatggg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036550 |
aacatcgatagcttgatctccttcatcatgtagtaaatcagcaaaaacaattttctgatgcagtaaagtgggacaaatttactctccctagaaatatggg |
47036451 |
T |
 |
| Q |
210 |
aggtcttggcacaaaggggcttgatgttatgaatcacaagcttgtttgatgaaac |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036450 |
aggtcttggcacaaaggggcttgatgttatgaatcacaagcttgtttgatgaaac |
47036396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University