View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1705_low_89 (Length: 257)
Name: NF1705_low_89
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1705_low_89 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 28500231 - 28500139
Alignment:
| Q |
1 |
catttgagctatctgttctctgtgatgctgaagttgctcttatcatcttctctccaagaggaaaactttatgaattttcaagctcctggtaag |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28500231 |
catttgagctatctgttctctgtgatgctgaagttgctcttatcatcttctctccaagaggaaaactttatgaattttcaagctcctggtaag |
28500139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 179 - 245
Target Start/End: Complemental strand, 28500053 - 28499987
Alignment:
| Q |
179 |
gcatcttaactatagcatatgctatagatccctcttcatgctatatcatttgttttaagagaataat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28500053 |
gcatcttaactatagcatatgctatagatccctcttcatgctatatcatttgttttaagagaataat |
28499987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 12 - 78
Target Start/End: Original strand, 5230047 - 5230113
Alignment:
| Q |
12 |
tctgttctctgtgatgctgaagttgctcttatcatcttctctccaagaggaaaactttatgaatttt |
78 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||| | | ||||| ||||||||||||| |
|
|
| T |
5230047 |
tctgttctttgtgatgctgaggttgctcttatcatcttctccactcgtggaaagctttatgaatttt |
5230113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 78
Target Start/End: Complemental strand, 34830948 - 34830882
Alignment:
| Q |
12 |
tctgttctctgtgatgctgaagttgctcttatcatcttctctccaagaggaaaactttatgaatttt |
78 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
34830948 |
tctgttctttgtgatgctgaagttgctcttatcatcttctccaacagaggaaaactctatgagtttt |
34830882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 12811986 - 12811945
Alignment:
| Q |
12 |
tctgttctctgtgatgctgaagttgctcttatcatcttctct |
53 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
12811986 |
tctgttctctgtgatgctgaagttgcccttatcattttctct |
12811945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 85
Target Start/End: Original strand, 12772332 - 12772396
Alignment:
| Q |
21 |
tgtgatgctgaagttgctcttatcatcttctctccaagaggaaaactttatgaattttcaagctc |
85 |
Q |
| |
|
||||||||||| ||||||||||| | ||||| |||||||| | |||||||||||| ||||||| |
|
|
| T |
12772332 |
tgtgatgctgaggttgctcttattgttttctcaccaagagggaggctttatgaatttacaagctc |
12772396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 5652964 - 5653006
Alignment:
| Q |
10 |
tatctgttctctgtgatgctgaagttgctcttatcatcttctc |
52 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
5652964 |
tatctgttctttgtgatgctgaagttgctcttattatcttctc |
5653006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 15 - 52
Target Start/End: Original strand, 45671480 - 45671517
Alignment:
| Q |
15 |
gttctctgtgatgctgaagttgctcttatcatcttctc |
52 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45671480 |
gttctttgtgatgctgaagttgctcttatcatcttctc |
45671517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 52
Target Start/End: Complemental strand, 46039640 - 46039609
Alignment:
| Q |
21 |
tgtgatgctgaagttgctcttatcatcttctc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46039640 |
tgtgatgctgaagttgctcttatcatcttctc |
46039609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University