View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706-Insertion-1 (Length: 252)
Name: NF1706-Insertion-1
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706-Insertion-1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 25172430 - 25172217
Alignment:
| Q |
11 |
ttacccttttatttcaaattataattaattgtttgcagattttaggttgagaatgagcacaacaaaacactgacagcatctgttaggaaccggcatcagc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25172430 |
ttacccttttatttcaaattataattaatagttttcacattttaggttgagaatgagcacaacaaaacactgacagcatctgttaggaaccggcatcagc |
25172331 |
T |
 |
| Q |
111 |
aatttgaacttgtgttagaaactggctatgatggaaatctaagcgaggtaagttgtagtagtattatacatacactatcattgatgtgttttcagttcgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25172330 |
aatttgaacttgtgttagaaactggctatgatggaaatctaagcgaggtaagttgt---agtattatacatacactatcattgatgtgttttcagttcgc |
25172234 |
T |
 |
| Q |
211 |
tggcatgacaatttggc |
227 |
Q |
| |
|
|||||| | |||||||| |
|
|
| T |
25172233 |
tggcataaaaatttggc |
25172217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University