View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706-Insertion-3 (Length: 219)
Name: NF1706-Insertion-3
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706-Insertion-3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 8 - 217
Target Start/End: Complemental strand, 33266386 - 33266177
Alignment:
| Q |
8 |
ccatggtcattatacctgtaattttttcaacttcttcaagttcaatacgaataaatgtgactccaacttgcccaaattaaccatgagtttgatagtcatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33266386 |
ccatggtcattatacctgtaattttttcaacttcttcaagttcaatacgaataaatgtgactccaacttgcccaaattaaccatgagtttgatagtcatt |
33266287 |
T |
 |
| Q |
108 |
tgattggtgaagaggatgctcgtaaacgtgactccaactcgccctcgcccgaattaaccatgcggctcttgggaagtcatcagctttgccaaggtattga |
207 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33266286 |
tgatcggtgaagaggatgctcataaacgtgactccaactcgccctcgcccaaattaaccatgcggctcttgggaagtcatcagctttgccaaggtattga |
33266187 |
T |
 |
| Q |
208 |
agctatctct |
217 |
Q |
| |
|
|||||||||| |
|
|
| T |
33266186 |
agctatctct |
33266177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University