View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17060_high_12 (Length: 265)
Name: NF17060_high_12
Description: NF17060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17060_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 11246685 - 11246448
Alignment:
| Q |
13 |
gcagaacctgtgtttgatgcagaggtgcacaagaattcatcaacacaacaaatgatgaatattgctgaacctggtggaatagctgcatccatggtcacag |
112 |
Q |
| |
|
|||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11246685 |
gcagaagctgtgtatgatgcagaggtgcataagaattcatcaacacaacaaatgatgaatattgctgaacctggtggaatagctgcatccatggccacag |
11246586 |
T |
|
| Q |
113 |
cagctaaactcaaccaagaaacatgaagaaccatggtcttttacaaatttccnnnnnnnnnnnnnngttaaaataagcttaacttgacattatacaaac- |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11246585 |
cagctaaactcaaccaagaaacatgaagaaccatggtcttttacaaatttccttttttctttttttgttaaaataagcttaacttgacattatacaaaca |
11246486 |
T |
|
| Q |
212 |
aagtcatgtaaattagtagttaccagtgagtttatttg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11246485 |
aagtcatgtaaattagtagttaccagtgagtttatttg |
11246448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University