View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17060_high_14 (Length: 246)
Name: NF17060_high_14
Description: NF17060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17060_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 61 - 105
Target Start/End: Complemental strand, 10469992 - 10469948
Alignment:
| Q |
61 |
agaaaattagccgcacttaactgaaattcttaatcattgtgacaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10469992 |
agaaaattagccgcacttaactgaaattcttaatcactgtgacaa |
10469948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 184 - 232
Target Start/End: Complemental strand, 10541821 - 10541773
Alignment:
| Q |
184 |
actctttgtacaaggcgaaataaatcaattcaactattgaatcatctta |
232 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
10541821 |
actctttgtagaaggcgaattaaatcaatccaactattgaatcatctta |
10541773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 10470166 - 10470113
Alignment:
| Q |
1 |
cttggtcactattataagcacaatttcactatgtttacactatttaatgctatta |
55 |
Q |
| |
|
|||||||| ||||||| | |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
10470166 |
cttggtcaatattata-gtacaatttcactacgtttacactatttaatggtatta |
10470113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 59
Target Start/End: Complemental strand, 10486248 - 10486211
Alignment:
| Q |
22 |
aatttcactatgtttacactatttaatgctattatttc |
59 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10486248 |
aatttcactacttttacactatttaatgctattatttc |
10486211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University