View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17060_high_20 (Length: 208)
Name: NF17060_high_20
Description: NF17060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17060_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 63 - 150
Target Start/End: Complemental strand, 49880442 - 49880353
Alignment:
| Q |
63 |
ctcagtttctttacgacttgcactcaaatttcagtacatcaaacac--atacaaggactgaaaatatataaagtcccatatgatatagct |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49880442 |
ctcagtttctttacgacttgcactcaaatttcagtacatcaaacacatatacaaggactgaaaatatataaagtcccatatgatatagct |
49880353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University