View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17060_low_14 (Length: 275)
Name: NF17060_low_14
Description: NF17060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17060_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 20896719 - 20896583
Alignment:
| Q |
1 |
aattcatagaaaacaagtaaatgtaattatgtcattagacctttgactcattctcatccttggcatagtcatcttcgagatgtctttgcattccgtcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
20896719 |
aattcatagaaaacaagtaaatgtaattatgtcattagacctttgactcattctcatccttggcatagtcatcttcctgatttctttgcattccgtcatc |
20896620 |
T |
|
| Q |
101 |
ctcacgcaattgcttatcaaaatcttcaccagctatt |
137 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20896619 |
ctcacgcaaatgcttatcaaaatcttcaccagctatt |
20896583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 215 - 260
Target Start/End: Complemental strand, 20896505 - 20896459
Alignment:
| Q |
215 |
catcagcattt-agtccattaaattgtaagagttagtgcaacctatt |
260 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20896505 |
catcagcattttagtccattaaattgtaagagttagtgcaacctatt |
20896459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University